Incidental Mutation 'R5022:Abca3'
ID389301
Institutional Source Beutler Lab
Gene Symbol Abca3
Ensembl Gene ENSMUSG00000024130
Gene NameATP-binding cassette, sub-family A (ABC1), member 3
SynonymsABC-C, 1810036E22Rik, Abc3
MMRRC Submission 042613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5022 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24351950-24410201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24374300 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 224 (R224C)
Ref Sequence ENSEMBL: ENSMUSP00000078544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039013] [ENSMUST00000079594] [ENSMUST00000117337]
Predicted Effect probably damaging
Transcript: ENSMUST00000039013
AA Change: R224C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045285
Gene: ENSMUSG00000024130
AA Change: R224C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 2.1e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 1.8e-35 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000079594
AA Change: R224C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078544
Gene: ENSMUSG00000024130
AA Change: R224C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 22 469 2.6e-28 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 923 1323 5.5e-39 PFAM
AAA 1408 1592 1.64e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000117337
AA Change: R224C
SMART Domains Protein: ENSMUSP00000113538
Gene: ENSMUSG00000024130
AA Change: R224C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 21 469 1.3e-29 PFAM
AAA 558 740 5.17e-10 SMART
Pfam:ABC2_membrane_3 761 1068 8.8e-29 PFAM
AAA 1153 1337 1.64e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136295
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149233
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency 99% (110/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The full transporter encoded by this gene may be involved in development of resistance to xenobiotics and engulfment during programmed cell death. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display neonatal lethality, respiratory failure, and severely impaired surfactant secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 TCGACTGC T 4: 53,041,570 probably null Het
Abca15 T C 7: 120,346,096 I465T probably damaging Het
Abcb4 T A 5: 8,909,054 probably null Het
Acan T C 7: 79,092,808 probably null Het
Aebp2 G A 6: 140,637,730 R109Q possibly damaging Het
Agfg2 A T 5: 137,660,160 probably null Het
Ankib1 T A 5: 3,734,011 I322F possibly damaging Het
AW551984 A T 9: 39,597,965 N293K probably benign Het
BC028528 T A 3: 95,888,823 probably benign Het
Bicc1 A G 10: 70,947,883 S393P possibly damaging Het
Birc6 A G 17: 74,692,332 Y4656C probably damaging Het
Bmp3 A G 5: 98,872,824 R369G probably damaging Het
C1d T A 11: 17,266,674 N135K probably benign Het
Ccdc148 G A 2: 58,827,632 A453V probably damaging Het
Cd163 C T 6: 124,325,288 T937I probably damaging Het
Celf2 C T 2: 6,607,847 probably benign Het
Chga T C 12: 102,562,837 W358R probably damaging Het
Clec4b2 A T 6: 123,200,956 S77C probably null Het
Crim1 T C 17: 78,280,129 V221A possibly damaging Het
D630003M21Rik A T 2: 158,217,633 S116T probably damaging Het
Dlg5 T C 14: 24,136,622 E1847G probably damaging Het
Dmxl1 T A 18: 49,895,127 I2206K probably damaging Het
Dusp7 T A 9: 106,373,741 L355Q probably damaging Het
Exd2 T A 12: 80,496,790 N582K probably damaging Het
Fbln1 G A 15: 85,237,626 S316N probably damaging Het
Fchsd1 A G 18: 37,964,810 I340T possibly damaging Het
Fn1 T C 1: 71,624,179 Y1050C probably damaging Het
Fsip2 A G 2: 82,979,429 I2031V probably benign Het
Gm10803 A C 2: 93,564,172 L96F probably damaging Het
Gm12169 T A 11: 46,528,532 D58E probably damaging Het
Gm14569 T C X: 36,430,817 D1413G probably benign Het
Gm15455 T C 1: 33,837,351 noncoding transcript Het
Gm1818 G C 12: 48,555,535 noncoding transcript Het
Gm4907 G A X: 23,907,241 G327E probably damaging Het
Gm5039 T C 12: 88,321,301 I61V probably benign Het
Gm5420 A T 10: 21,691,727 noncoding transcript Het
Gm6803 A T 12: 88,018,711 S21T unknown Het
Gm7104 A T 12: 88,285,759 noncoding transcript Het
Gp2 A G 7: 119,449,114 I427T probably damaging Het
Gpc4 G A X: 52,074,563 R148C probably damaging Het
Gpr142 A C 11: 114,804,388 S60R probably benign Het
Helz2 T C 2: 181,240,569 R144G probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Hnf4g G T 3: 3,644,587 A144S probably damaging Het
Irs2 A C 8: 10,987,012 *1322G probably null Het
Keg1 A G 19: 12,719,157 N288S probably damaging Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Klhl1 G A 14: 96,136,706 P635S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lsm11 T C 11: 45,944,839 D25G probably damaging Het
Manea A T 4: 26,336,630 Y215* probably null Het
Mdga2 C T 12: 66,470,760 C100Y possibly damaging Het
Mthfd1 T G 12: 76,294,374 V480G probably damaging Het
Mthfd1 T A 12: 76,301,328 M582K probably damaging Het
Myh7b G C 2: 155,632,373 R1669S possibly damaging Het
Nanos1 T C 19: 60,756,980 Y239H probably damaging Het
Nat8 G A 6: 85,830,857 T98I possibly damaging Het
Ndufs3 C A 2: 90,898,660 A161S probably benign Het
Nexmif A T X: 104,087,350 N320K probably damaging Het
Olfr1216 A G 2: 89,014,043 V7A probably damaging Het
Olfr1228 C T 2: 89,249,417 M92I probably benign Het
Olfr164 A T 16: 19,286,059 V228D probably damaging Het
Olfr239 T C 17: 33,199,777 F239S probably damaging Het
Olfr457 A T 6: 42,471,287 V297E possibly damaging Het
Olfr589 G A 7: 103,155,735 P4L probably benign Het
Olfr727 T C 14: 50,127,012 V145A possibly damaging Het
Olfr822 T C 10: 130,074,593 L61P probably damaging Het
Pcdhb14 T A 18: 37,450,170 N776K probably benign Het
Pip5k1c G A 10: 81,310,889 probably null Het
Plk4 G A 3: 40,802,077 probably null Het
Prmt8 A G 6: 127,711,163 Y231H possibly damaging Het
Prpf4b T C 13: 34,883,599 probably benign Het
Ptpn21 G A 12: 98,679,407 R1091C probably damaging Het
Pwwp2b C T 7: 139,255,578 P312S possibly damaging Het
Rad21 A T 15: 51,966,706 I503K probably benign Het
Rai14 A G 15: 10,574,506 S789P probably damaging Het
Rbm26 C T 14: 105,144,252 D486N probably damaging Het
Rnf20 A G 4: 49,642,016 probably benign Het
Ros1 A G 10: 52,124,075 V1118A possibly damaging Het
Sema3d A C 5: 12,584,956 Y663S probably damaging Het
Serpina6 A G 12: 103,651,712 W281R probably damaging Het
Slc8a3 A G 12: 81,199,558 V900A probably damaging Het
Spats2l G T 1: 57,879,556 V30L probably damaging Het
Spg21 A G 9: 65,475,949 D139G probably damaging Het
Sun3 T C 11: 9,038,314 T3A probably damaging Het
Tcrg-V1 T A 13: 19,340,231 S42T probably benign Het
Tep1 A G 14: 50,828,999 Y2335H probably benign Het
Timm21 C A 18: 84,949,414 V112L possibly damaging Het
Tlk1 A T 2: 70,742,065 N386K probably benign Het
Trappc10 G T 10: 78,217,160 F260L possibly damaging Het
Trmt112 T C 19: 6,910,753 V91A probably benign Het
Ucp2 A T 7: 100,498,372 N186I possibly damaging Het
Vmn1r119 A G 7: 21,012,320 S46P probably benign Het
Vmn2r101 A T 17: 19,611,387 probably null Het
Vmn2r105 T A 17: 20,208,414 H800L probably damaging Het
Vmn2r69 T C 7: 85,411,159 M406V possibly damaging Het
Vmn2r84 A G 10: 130,386,548 L601P probably damaging Het
Vps16 A G 2: 130,439,452 S235G probably benign Het
Wap T C 11: 6,637,339 probably benign Het
Wdr11 A G 7: 129,624,711 I744M probably benign Het
Xiap T C X: 42,094,465 F23L probably benign Het
Xkr7 A G 2: 153,054,380 T385A probably benign Het
Zfp524 A T 7: 5,018,417 I315F probably benign Het
Zfp62 T A 11: 49,215,729 S216T probably damaging Het
Znfx1 T C 2: 167,039,826 Y217C probably damaging Het
Other mutations in Abca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Abca3 APN 17 24374246 missense probably damaging 1.00
IGL01538:Abca3 APN 17 24376473 missense possibly damaging 0.64
IGL01633:Abca3 APN 17 24397353 nonsense probably null
IGL01837:Abca3 APN 17 24408697 missense probably damaging 1.00
IGL01986:Abca3 APN 17 24408114 missense probably damaging 1.00
IGL02049:Abca3 APN 17 24376730 nonsense probably null
IGL02186:Abca3 APN 17 24377740 missense possibly damaging 0.95
IGL02794:Abca3 APN 17 24402411 missense probably benign 0.05
IGL02962:Abca3 APN 17 24400409 missense probably damaging 1.00
IGL02963:Abca3 APN 17 24384529 missense probably damaging 1.00
IGL03118:Abca3 APN 17 24400450 missense probably benign 0.17
IGL03144:Abca3 APN 17 24381964 missense probably benign 0.37
R0028:Abca3 UTSW 17 24377724 missense probably benign 0.39
R0278:Abca3 UTSW 17 24381920 missense probably benign 0.09
R0570:Abca3 UTSW 17 24374399 missense probably benign
R0825:Abca3 UTSW 17 24400577 missense probably damaging 1.00
R1164:Abca3 UTSW 17 24402331 missense probably damaging 1.00
R1348:Abca3 UTSW 17 24374238 splice site probably null
R1557:Abca3 UTSW 17 24399980 missense possibly damaging 0.46
R1661:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1665:Abca3 UTSW 17 24377842 missense probably damaging 0.99
R1754:Abca3 UTSW 17 24377779 missense probably benign 0.00
R1828:Abca3 UTSW 17 24366197 missense probably benign 0.34
R1834:Abca3 UTSW 17 24376692 missense probably benign 0.00
R1996:Abca3 UTSW 17 24387532 missense probably damaging 1.00
R2032:Abca3 UTSW 17 24366082 splice site probably benign
R2100:Abca3 UTSW 17 24408209 missense probably damaging 0.99
R2154:Abca3 UTSW 17 24377719 missense probably damaging 1.00
R2240:Abca3 UTSW 17 24376443 missense probably damaging 0.98
R2281:Abca3 UTSW 17 24376726 missense possibly damaging 0.88
R2994:Abca3 UTSW 17 24384564 missense probably damaging 1.00
R4091:Abca3 UTSW 17 24397482 missense probably damaging 1.00
R4294:Abca3 UTSW 17 24400569 missense possibly damaging 0.96
R4496:Abca3 UTSW 17 24383973 missense possibly damaging 0.93
R4633:Abca3 UTSW 17 24387529 missense probably null 1.00
R4866:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5023:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5072:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5073:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5074:Abca3 UTSW 17 24374300 missense probably damaging 0.97
R5123:Abca3 UTSW 17 24384460 missense possibly damaging 0.95
R5157:Abca3 UTSW 17 24408122 missense probably damaging 1.00
R5183:Abca3 UTSW 17 24374453 missense probably benign 0.39
R5269:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R5566:Abca3 UTSW 17 24383927 missense probably benign
R5579:Abca3 UTSW 17 24376729 missense probably damaging 0.97
R5620:Abca3 UTSW 17 24396470 missense probably benign 0.05
R5755:Abca3 UTSW 17 24398454 missense probably damaging 1.00
R5954:Abca3 UTSW 17 24397416 missense probably benign 0.00
R6041:Abca3 UTSW 17 24376380 missense probably damaging 0.99
R6187:Abca3 UTSW 17 24408167 missense possibly damaging 0.88
R6253:Abca3 UTSW 17 24397552 missense probably benign 0.01
R6375:Abca3 UTSW 17 24387562 missense possibly damaging 0.96
R6487:Abca3 UTSW 17 24397472 missense possibly damaging 0.81
R6616:Abca3 UTSW 17 24384535 missense probably damaging 1.00
R6632:Abca3 UTSW 17 24384470 missense probably benign
R6781:Abca3 UTSW 17 24374406 missense possibly damaging 0.95
R6918:Abca3 UTSW 17 24408658 missense probably damaging 1.00
R6962:Abca3 UTSW 17 24364726 missense probably benign 0.39
R7163:Abca3 UTSW 17 24364942 missense probably benign
R7199:Abca3 UTSW 17 24377707 missense probably damaging 1.00
R7287:Abca3 UTSW 17 24385887 missense possibly damaging 0.91
R7303:Abca3 UTSW 17 24398521 missense possibly damaging 0.83
R7338:Abca3 UTSW 17 24376743 missense possibly damaging 0.95
R7430:Abca3 UTSW 17 24364958 critical splice donor site probably null
R7437:Abca3 UTSW 17 24400498 missense probably damaging 0.99
R7776:Abca3 UTSW 17 24386276 missense possibly damaging 0.77
R7805:Abca3 UTSW 17 24405154 critical splice donor site probably null
R7811:Abca3 UTSW 17 24397388 missense probably benign 0.00
R7848:Abca3 UTSW 17 24384532 missense probably damaging 1.00
R7859:Abca3 UTSW 17 24384526 missense probably damaging 1.00
R7877:Abca3 UTSW 17 24384023 nonsense probably null
R7893:Abca3 UTSW 17 24385466 missense probably damaging 1.00
R7910:Abca3 UTSW 17 24385853 missense probably benign 0.09
R7911:Abca3 UTSW 17 24398504 missense probably damaging 1.00
R7964:Abca3 UTSW 17 24402436 missense probably benign 0.26
R8016:Abca3 UTSW 17 24364952 missense probably benign 0.06
R8028:Abca3 UTSW 17 24407697 missense probably benign 0.02
R8150:Abca3 UTSW 17 24396548 missense probably benign 0.08
R8298:Abca3 UTSW 17 24385401 missense probably damaging 1.00
R8444:Abca3 UTSW 17 24383985 missense probably damaging 0.98
R8505:Abca3 UTSW 17 24374497 missense probably damaging 0.97
R8547:Abca3 UTSW 17 24397500 missense probably benign 0.00
X0018:Abca3 UTSW 17 24396480 missense possibly damaging 0.63
Z1177:Abca3 UTSW 17 24408236 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGTAAAGTTACCCATTGCCTCC -3'
(R):5'- CTCAGACTGACTTGCCATGC -3'

Sequencing Primer
(F):5'- AAAGTTACCCATTGCCTCCTCTGG -3'
(R):5'- TTGCCATGCACAGAGGGTTAC -3'
Posted On2016-06-06