Incidental Mutation 'R5033:Col3a1'
ID 389318
Institutional Source Beutler Lab
Gene Symbol Col3a1
Ensembl Gene ENSMUSG00000026043
Gene Name collagen, type III, alpha 1
Synonyms Col3a-1
MMRRC Submission 042624-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock # R5033 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 45311538-45349706 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 45346110 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 129 (D129A)
Ref Sequence ENSEMBL: ENSMUSP00000139802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087883] [ENSMUST00000186021]
AlphaFold P08121
Predicted Effect unknown
Transcript: ENSMUST00000087883
AA Change: D1262A
SMART Domains Protein: ENSMUSP00000085192
Gene: ENSMUSG00000026043
AA Change: D1262A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWC 33 89 2.73e-20 SMART
low complexity region 100 140 N/A INTRINSIC
low complexity region 163 227 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
internal_repeat_2 249 284 3.45e-13 PROSPERO
internal_repeat_1 250 290 1.9e-17 PROSPERO
Pfam:Collagen 293 366 7.3e-9 PFAM
low complexity region 368 419 N/A INTRINSIC
internal_repeat_4 423 476 2.52e-11 PROSPERO
internal_repeat_1 427 488 1.9e-17 PROSPERO
internal_repeat_3 427 491 7.39e-12 PROSPERO
internal_repeat_2 456 491 3.45e-13 PROSPERO
Pfam:Collagen 533 592 2.6e-11 PFAM
low complexity region 632 680 N/A INTRINSIC
low complexity region 683 776 N/A INTRINSIC
low complexity region 784 815 N/A INTRINSIC
low complexity region 818 855 N/A INTRINSIC
low complexity region 865 921 N/A INTRINSIC
low complexity region 925 950 N/A INTRINSIC
low complexity region 953 974 N/A INTRINSIC
internal_repeat_4 975 1028 2.52e-11 PROSPERO
internal_repeat_3 976 1029 7.39e-12 PROSPERO
internal_repeat_5 977 991 3.33e-5 PROSPERO
internal_repeat_5 1019 1033 3.33e-5 PROSPERO
low complexity region 1037 1058 N/A INTRINSIC
Pfam:Collagen 1076 1135 5.6e-13 PFAM
Pfam:Collagen 1136 1209 4.3e-11 PFAM
COLFI 1229 1464 5.73e-166 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186021
AA Change: D129A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139802
Gene: ENSMUSG00000026043
AA Change: D129A

DomainStartEndE-ValueType
Pfam:Collagen 3 62 1.5e-11 PFAM
COLFI 96 244 7.9e-68 SMART
Meta Mutation Damage Score 0.8667 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type III collagen found in bone, cartilage, dentin, tendon, bone marrow stroma and other connective tissue. The encoded protein forms homotrimeric type III procollagen that undergoes proteolytic processing during fibril formation. A majority of mice lacking the encoded protein die within two days of birth but about 5% of the animals survive to adulthood. The surviving mice exhibit severe cortical malformation and experience significantly shorter lifespan. The mutant mouse named "tight skin 2" exhibiting systemic sclerosis phenotype was found to harbor a missense point mutation in this gene. A pseudogene of this gene has been defined on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Most homozygous mutants die within 48 hours after birth. Surviving mutants have reduced body size, skin lesions, enlarged intestines, and die by 6 months of age from ruptured blood vessels. Occasionally intestinal rupture also results in early death. Heterozygotes exhibit tight skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,279,414 V149A probably benign Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4931406P16Rik C T 7: 34,245,812 G336S probably benign Het
9930111J21Rik1 G A 11: 48,947,706 R685W probably damaging Het
Arhgap10 A T 8: 77,382,757 L399H probably damaging Het
Arih2 AGCCG AG 9: 108,611,660 probably benign Het
Atp13a2 A G 4: 141,000,821 H575R possibly damaging Het
Bbof1 G A 12: 84,411,270 probably null Het
Catsperg2 A C 7: 29,710,134 Y545D possibly damaging Het
Cdc42bpa T A 1: 180,065,015 I248N probably damaging Het
Cdk11b A T 4: 155,648,825 probably benign Het
Cfap46 C A 7: 139,603,860 L90F probably benign Het
Cndp2 A G 18: 84,670,829 L276P possibly damaging Het
Daam1 C A 12: 71,946,520 H354Q unknown Het
Dnah5 T A 15: 28,421,678 F3892Y probably damaging Het
Dnajb3 A G 1: 88,205,023 V219A possibly damaging Het
Drd5 A G 5: 38,320,201 H179R probably damaging Het
Dym A G 18: 75,119,161 N333D possibly damaging Het
Eif2b3 A G 4: 117,052,736 D156G probably damaging Het
Emc1 A G 4: 139,371,696 D830G probably damaging Het
F13a1 A C 13: 36,988,856 I183M probably damaging Het
Fam136b-ps T A 15: 31,276,897 probably benign Het
Fdft1 C A 14: 63,163,404 K93N probably damaging Het
Gcc2 A G 10: 58,278,806 D959G probably damaging Het
Gm14085 T A 2: 122,522,914 probably null Het
Gm853 C T 4: 130,221,615 probably null Het
Gp2 A G 7: 119,454,291 V149A probably damaging Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Hdac9 A T 12: 34,373,907 C587S probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Iars2 A G 1: 185,317,928 V453A possibly damaging Het
Il1r1 T G 1: 40,293,524 C121W probably damaging Het
Jazf1 A G 6: 52,777,540 Y184H probably damaging Het
Kel A T 6: 41,699,055 Y234N probably damaging Het
Khk G A 5: 30,929,660 G186D probably damaging Het
Klf4 A T 4: 55,530,301 M270K probably benign Het
Kmt2c G A 5: 25,314,708 L2135F probably benign Het
Krtap15 A G 16: 88,829,156 Y37C probably damaging Het
Lars A G 18: 42,214,776 F994S possibly damaging Het
Lrp8 T C 4: 107,834,755 probably null Het
Lrrc2 A T 9: 110,980,919 D341V probably damaging Het
Map4k4 A G 1: 40,007,502 K646R probably damaging Het
Mrps9 T A 1: 42,895,331 probably null Het
Olfr1130 T A 2: 87,607,711 C108S probably damaging Het
Olfr745 T A 14: 50,643,162 Y288N probably damaging Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pcnt A T 10: 76,399,945 C1401S possibly damaging Het
Pdgfrb A T 18: 61,077,668 K749M probably damaging Het
Pigo A T 4: 43,019,412 W969R probably null Het
Pigr A T 1: 130,844,699 Y218F probably damaging Het
Pih1d1 A G 7: 45,154,854 probably benign Het
Pik3cg A T 12: 32,199,196 probably null Het
Pik3r6 A T 11: 68,533,468 K300* probably null Het
Pip5k1c A G 10: 81,305,250 D64G probably damaging Het
Piwil2 A T 14: 70,421,593 I161K possibly damaging Het
Pou3f1 A G 4: 124,658,656 E317G probably damaging Het
Prdm8 C T 5: 98,185,212 Q213* probably null Het
Prpf6 T A 2: 181,650,106 C739S possibly damaging Het
Psmc3 T A 2: 91,054,608 S40T probably benign Het
Psmd3 A T 11: 98,682,824 D32V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rapgef6 A T 11: 54,691,381 H1373L possibly damaging Het
Rnf207 A C 4: 152,313,209 S328A probably benign Het
Ros1 C T 10: 52,128,416 probably null Het
Ryr2 T A 13: 11,587,254 I4581F possibly damaging Het
Sacm1l C T 9: 123,586,399 R480W probably damaging Het
Sec16a A G 2: 26,419,649 V664A probably benign Het
Selenoo T A 15: 89,092,766 M207K probably damaging Het
Sh3tc2 G A 18: 62,014,891 probably null Het
Slco2b1 G T 7: 99,660,049 Q692K probably benign Het
Slfn4 A T 11: 83,186,797 D137V probably damaging Het
Srrm2 G A 17: 23,820,618 A2175T probably damaging Het
Stard9 T A 2: 120,693,399 C692S probably benign Het
Sulf2 T A 2: 166,081,622 D559V probably benign Het
Tbpl2 T C 2: 24,087,158 I283V probably benign Het
Tmem19 A G 10: 115,359,761 F46S probably benign Het
Trp63 T A 16: 25,763,306 Y35N probably damaging Het
Ttn T A 2: 76,886,442 probably benign Het
Ube2z A T 11: 96,050,322 H331Q probably benign Het
Ubr1 C T 2: 120,911,997 probably null Het
Uhrf1bp1 A G 17: 27,886,864 E788G probably damaging Het
Vmn1r235 A T 17: 21,262,288 I292F possibly damaging Het
Vmn2r1 T A 3: 64,105,080 D787E probably damaging Het
Vmn2r3 A G 3: 64,259,799 V637A probably benign Het
Xpnpep1 C A 19: 53,006,175 V341L probably benign Het
Yme1l1 A G 2: 23,194,747 D619G probably damaging Het
Zfp597 G A 16: 3,866,638 P85S probably damaging Het
Zscan20 A G 4: 128,586,128 S857P probably benign Het
Other mutations in Col3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Col3a1 APN 1 45347135 missense probably damaging 1.00
IGL00928:Col3a1 APN 1 45340858 intron probably benign
IGL00958:Col3a1 APN 1 45327595 missense unknown
IGL01353:Col3a1 APN 1 45333638 unclassified probably benign
IGL01820:Col3a1 APN 1 45321608 missense unknown
IGL01839:Col3a1 APN 1 45311830 missense unknown
IGL02517:Col3a1 APN 1 45325803 critical splice acceptor site probably null
IGL02879:Col3a1 APN 1 45340959 intron probably benign
IGL02960:Col3a1 APN 1 45328455 missense unknown
IGL03245:Col3a1 APN 1 45331109 unclassified probably benign
IGL03308:Col3a1 APN 1 45330617 splice site probably benign
Creation UTSW 1 45345984 missense probably damaging 1.00
Kraken UTSW 1 45327866 splice site probably null
Wealth UTSW 1 45340312 splice site probably benign
IGL03050:Col3a1 UTSW 1 45328925 splice site probably null
PIT4520001:Col3a1 UTSW 1 45335783 critical splice donor site probably null
R0063:Col3a1 UTSW 1 45330541 splice site probably benign
R0122:Col3a1 UTSW 1 45340897 intron probably benign
R0131:Col3a1 UTSW 1 45328868 splice site probably benign
R0762:Col3a1 UTSW 1 45321526 missense unknown
R0765:Col3a1 UTSW 1 45336651 unclassified probably benign
R0853:Col3a1 UTSW 1 45343324 intron probably benign
R0898:Col3a1 UTSW 1 45333993 unclassified probably benign
R1170:Col3a1 UTSW 1 45327601 missense unknown
R1170:Col3a1 UTSW 1 45347724 missense probably damaging 1.00
R1440:Col3a1 UTSW 1 45343312 splice site probably null
R1449:Col3a1 UTSW 1 45321611 missense unknown
R1526:Col3a1 UTSW 1 45321688 missense unknown
R1572:Col3a1 UTSW 1 45345968 missense possibly damaging 0.95
R1585:Col3a1 UTSW 1 45327866 splice site probably null
R1616:Col3a1 UTSW 1 45328488 critical splice donor site probably null
R1691:Col3a1 UTSW 1 45348616 unclassified probably benign
R1876:Col3a1 UTSW 1 45342235 splice site probably null
R1937:Col3a1 UTSW 1 45334293 unclassified probably benign
R2093:Col3a1 UTSW 1 45332990 missense probably damaging 1.00
R2110:Col3a1 UTSW 1 45330145 missense unknown
R2119:Col3a1 UTSW 1 45346121 missense probably damaging 1.00
R2256:Col3a1 UTSW 1 45321632 missense unknown
R2327:Col3a1 UTSW 1 45338611 unclassified probably benign
R2518:Col3a1 UTSW 1 45337512 unclassified probably benign
R2991:Col3a1 UTSW 1 45335779 unclassified probably benign
R3405:Col3a1 UTSW 1 45338753 unclassified probably benign
R3784:Col3a1 UTSW 1 45347135 missense probably damaging 1.00
R3847:Col3a1 UTSW 1 45321990 missense unknown
R3848:Col3a1 UTSW 1 45321990 missense unknown
R3849:Col3a1 UTSW 1 45321990 missense unknown
R4502:Col3a1 UTSW 1 45348677 unclassified probably benign
R4503:Col3a1 UTSW 1 45348677 unclassified probably benign
R4764:Col3a1 UTSW 1 45346110 missense probably damaging 1.00
R4839:Col3a1 UTSW 1 45323803 splice site probably null
R4934:Col3a1 UTSW 1 45339952 unclassified probably benign
R5123:Col3a1 UTSW 1 45333596 unclassified probably benign
R5190:Col3a1 UTSW 1 45329084 missense unknown
R5190:Col3a1 UTSW 1 45344807 intron probably benign
R5375:Col3a1 UTSW 1 45347899 splice site probably null
R5407:Col3a1 UTSW 1 45346052 missense probably benign 0.03
R5627:Col3a1 UTSW 1 45331560 unclassified probably benign
R5642:Col3a1 UTSW 1 45331712 unclassified probably benign
R6014:Col3a1 UTSW 1 45321579 nonsense probably null
R6052:Col3a1 UTSW 1 45345013 unclassified probably benign
R6263:Col3a1 UTSW 1 45321575 missense unknown
R6453:Col3a1 UTSW 1 45339378 unclassified probably benign
R6463:Col3a1 UTSW 1 45342205 intron probably benign
R6488:Col3a1 UTSW 1 45331534 unclassified probably benign
R6525:Col3a1 UTSW 1 45347179 missense possibly damaging 0.88
R6637:Col3a1 UTSW 1 45347730 missense probably damaging 1.00
R6704:Col3a1 UTSW 1 45347732 missense probably damaging 1.00
R6744:Col3a1 UTSW 1 45338622 unclassified probably benign
R6745:Col3a1 UTSW 1 45338622 unclassified probably benign
R6747:Col3a1 UTSW 1 45338622 unclassified probably benign
R6858:Col3a1 UTSW 1 45345984 missense probably damaging 1.00
R6903:Col3a1 UTSW 1 45331988 missense probably damaging 0.96
R7189:Col3a1 UTSW 1 45333657 missense unknown
R7194:Col3a1 UTSW 1 45331700 missense unknown
R7199:Col3a1 UTSW 1 45332141 missense probably null 0.99
R7204:Col3a1 UTSW 1 45322418 missense unknown
R7304:Col3a1 UTSW 1 45347811 missense unknown
R7378:Col3a1 UTSW 1 45327647 splice site probably null
R7398:Col3a1 UTSW 1 45327813 missense unknown
R7742:Col3a1 UTSW 1 45345001 missense unknown
R8072:Col3a1 UTSW 1 45321574 missense unknown
R8177:Col3a1 UTSW 1 45335764 missense unknown
R8183:Col3a1 UTSW 1 45334810 missense unknown
R8445:Col3a1 UTSW 1 45341180 nonsense probably null
R8490:Col3a1 UTSW 1 45345956 missense probably benign 0.01
R8546:Col3a1 UTSW 1 45340939 intron probably benign
R8720:Col3a1 UTSW 1 45347733 missense unknown
R8733:Col3a1 UTSW 1 45340312 splice site probably benign
R8888:Col3a1 UTSW 1 45339979 missense unknown
R9227:Col3a1 UTSW 1 45343978 missense unknown
R9230:Col3a1 UTSW 1 45343978 missense unknown
R9302:Col3a1 UTSW 1 45311820 nonsense probably null
R9366:Col3a1 UTSW 1 45341231 missense unknown
Z1177:Col3a1 UTSW 1 45311800 missense unknown
Predicted Primers PCR Primer
(F):5'- TTACTTATCTAGGGCTCGCCAG -3'
(R):5'- ACCTTCAATGCTCCTTCAAACATTG -3'

Sequencing Primer
(F):5'- CTGCTGCCATTGCTGGAG -3'
(R):5'- CCTCCTTACTATCAAGCATTTTCAAC -3'
Posted On 2016-06-06