Mutagenetix > Incidental Mutation

Incidental Mutation 'R5033:Cdc42bpa'

389323

Institutional Source

Beutler Lab

Gene Symbol

Cdc42bpa

Ensembl Gene

ENSMUSG00000026490

Gene Name

CDC42 binding protein kinase alpha

Synonyms

A930014J19Rik, DMPK-like

MMRRC Submission

042624-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.742) question?

Stock #

R5033 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

179960472-180165603 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 180065015 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 248 (I248N)

Ref Sequence

ENSEMBL: ENSMUSP00000148469 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000134959] [ENSMUST00000212756]

AlphaFold

Q3UU96

Predicted Effect

probably damaging
Transcript: ENSMUST00000076687
AA Change: I248N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: I248N

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	588	N/A	INTRINSIC
coiled coil region	632	735	N/A	INTRINSIC
Pfam:DMPK_coil	800	860	2.7e-29	PFAM
C1	919	968	4.09e-7	SMART
PH	989	1109	6.02e-8	SMART
CNH	1134	1411	3.37e-17	SMART
low complexity region	1456	1468	N/A	INTRINSIC
PBD	1477	1512	2.05e-10	SMART
low complexity region	1531	1546	N/A	INTRINSIC
low complexity region	1567	1580	N/A	INTRINSIC
low complexity region	1606	1620	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097450
AA Change: I248N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: I248N

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	669	N/A	INTRINSIC
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.2e-29	PFAM
C1	1000	1049	4.09e-7	SMART
PH	1070	1190	6.02e-8	SMART
CNH	1215	1492	3.37e-17	SMART
low complexity region	1537	1549	N/A	INTRINSIC
PBD	1558	1593	2.05e-10	SMART
low complexity region	1612	1627	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC
low complexity region	1687	1701	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000097453
AA Change: I248N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: I248N

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
coiled coil region	435	669	N/A	INTRINSIC
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.5e-29	PFAM
C1	972	1021	4.09e-7	SMART
PH	1042	1162	6.02e-8	SMART
CNH	1187	1464	3.37e-17	SMART
low complexity region	1509	1521	N/A	INTRINSIC
PBD	1530	1565	2.05e-10	SMART
low complexity region	1584	1599	N/A	INTRINSIC
low complexity region	1620	1633	N/A	INTRINSIC
low complexity region	1659	1673	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111117
AA Change: I248N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: I248N

Domain	Start	End	E-Value	Type
S_TKc	77	343	1.06e-86	SMART
S_TK_X	344	406	1.18e-15	SMART
low complexity region	484	499	N/A	INTRINSIC
Pfam:KELK	529	608	1.1e-32	PFAM
coiled coil region	713	816	N/A	INTRINSIC
Pfam:DMPK_coil	881	941	2.6e-29	PFAM
C1	1013	1062	4.09e-7	SMART
PH	1083	1203	6.02e-8	SMART
CNH	1228	1505	3.37e-17	SMART
low complexity region	1550	1562	N/A	INTRINSIC
PBD	1571	1606	2.05e-10	SMART
low complexity region	1625	1640	N/A	INTRINSIC
low complexity region	1661	1674	N/A	INTRINSIC
low complexity region	1700	1714	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134959

SMART Domains

Protein: ENSMUSP00000142018
Gene: ENSMUSG00000026490

Domain	Start	End	E-Value	Type
PDB:4AW2\|A	2	90	1e-58	PDB
SCOP:d1koba_	50	90	7e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212756
AA Change: I248N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,279,414	V149A	probably benign	Het
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
4931406P16Rik	C	T	7: 34,245,812	G336S	probably benign	Het
9930111J21Rik1	G	A	11: 48,947,706	R685W	probably damaging	Het
Arhgap10	A	T	8: 77,382,757	L399H	probably damaging	Het
Arih2	AGCCG	AG	9: 108,611,660		probably benign	Het
Atp13a2	A	G	4: 141,000,821	H575R	possibly damaging	Het
Bbof1	G	A	12: 84,411,270		probably null	Het
Catsperg2	A	C	7: 29,710,134	Y545D	possibly damaging	Het
Cdk11b	A	T	4: 155,648,825		probably benign	Het
Cfap46	C	A	7: 139,603,860	L90F	probably benign	Het
Cndp2	A	G	18: 84,670,829	L276P	possibly damaging	Het
Col3a1	A	C	1: 45,346,110	D129A	probably damaging	Het
Daam1	C	A	12: 71,946,520	H354Q	unknown	Het
Dnah5	T	A	15: 28,421,678	F3892Y	probably damaging	Het
Dnajb3	A	G	1: 88,205,023	V219A	possibly damaging	Het
Drd5	A	G	5: 38,320,201	H179R	probably damaging	Het
Dym	A	G	18: 75,119,161	N333D	possibly damaging	Het
Eif2b3	A	G	4: 117,052,736	D156G	probably damaging	Het
Emc1	A	G	4: 139,371,696	D830G	probably damaging	Het
F13a1	A	C	13: 36,988,856	I183M	probably damaging	Het
Fam136b-ps	T	A	15: 31,276,897		probably benign	Het
Fdft1	C	A	14: 63,163,404	K93N	probably damaging	Het
Gcc2	A	G	10: 58,278,806	D959G	probably damaging	Het
Gm14085	T	A	2: 122,522,914		probably null	Het
Gm853	C	T	4: 130,221,615		probably null	Het
Gp2	A	G	7: 119,454,291	V149A	probably damaging	Het
Gpc1	G	A	1: 92,857,029	G308D	probably damaging	Het
Hdac9	A	T	12: 34,373,907	C587S	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Iars2	A	G	1: 185,317,928	V453A	possibly damaging	Het
Il1r1	T	G	1: 40,293,524	C121W	probably damaging	Het
Jazf1	A	G	6: 52,777,540	Y184H	probably damaging	Het
Kel	A	T	6: 41,699,055	Y234N	probably damaging	Het
Khk	G	A	5: 30,929,660	G186D	probably damaging	Het
Klf4	A	T	4: 55,530,301	M270K	probably benign	Het
Kmt2c	G	A	5: 25,314,708	L2135F	probably benign	Het
Krtap15	A	G	16: 88,829,156	Y37C	probably damaging	Het
Lars	A	G	18: 42,214,776	F994S	possibly damaging	Het
Lrp8	T	C	4: 107,834,755		probably null	Het
Lrrc2	A	T	9: 110,980,919	D341V	probably damaging	Het
Map4k4	A	G	1: 40,007,502	K646R	probably damaging	Het
Mrps9	T	A	1: 42,895,331		probably null	Het
Olfr1130	T	A	2: 87,607,711	C108S	probably damaging	Het
Olfr745	T	A	14: 50,643,162	Y288N	probably damaging	Het
Olfr898	C	T	9: 38,349,628	H176Y	probably damaging	Het
Pcnt	A	T	10: 76,399,945	C1401S	possibly damaging	Het
Pdgfrb	A	T	18: 61,077,668	K749M	probably damaging	Het
Pigo	A	T	4: 43,019,412	W969R	probably null	Het
Pigr	A	T	1: 130,844,699	Y218F	probably damaging	Het
Pih1d1	A	G	7: 45,154,854		probably benign	Het
Pik3cg	A	T	12: 32,199,196		probably null	Het
Pik3r6	A	T	11: 68,533,468	K300*	probably null	Het
Pip5k1c	A	G	10: 81,305,250	D64G	probably damaging	Het
Piwil2	A	T	14: 70,421,593	I161K	possibly damaging	Het
Pou3f1	A	G	4: 124,658,656	E317G	probably damaging	Het
Prdm8	C	T	5: 98,185,212	Q213*	probably null	Het
Prpf6	T	A	2: 181,650,106	C739S	possibly damaging	Het
Psmc3	T	A	2: 91,054,608	S40T	probably benign	Het
Psmd3	A	T	11: 98,682,824	D32V	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rapgef6	A	T	11: 54,691,381	H1373L	possibly damaging	Het
Rnf207	A	C	4: 152,313,209	S328A	probably benign	Het
Ros1	C	T	10: 52,128,416		probably null	Het
Ryr2	T	A	13: 11,587,254	I4581F	possibly damaging	Het
Sacm1l	C	T	9: 123,586,399	R480W	probably damaging	Het
Sec16a	A	G	2: 26,419,649	V664A	probably benign	Het
Selenoo	T	A	15: 89,092,766	M207K	probably damaging	Het
Sh3tc2	G	A	18: 62,014,891		probably null	Het
Slco2b1	G	T	7: 99,660,049	Q692K	probably benign	Het
Slfn4	A	T	11: 83,186,797	D137V	probably damaging	Het
Srrm2	G	A	17: 23,820,618	A2175T	probably damaging	Het
Stard9	T	A	2: 120,693,399	C692S	probably benign	Het
Sulf2	T	A	2: 166,081,622	D559V	probably benign	Het
Tbpl2	T	C	2: 24,087,158	I283V	probably benign	Het
Tmem19	A	G	10: 115,359,761	F46S	probably benign	Het
Trp63	T	A	16: 25,763,306	Y35N	probably damaging	Het
Ttn	T	A	2: 76,886,442		probably benign	Het
Ube2z	A	T	11: 96,050,322	H331Q	probably benign	Het
Ubr1	C	T	2: 120,911,997		probably null	Het
Uhrf1bp1	A	G	17: 27,886,864	E788G	probably damaging	Het
Vmn1r235	A	T	17: 21,262,288	I292F	possibly damaging	Het
Vmn2r1	T	A	3: 64,105,080	D787E	probably damaging	Het
Vmn2r3	A	G	3: 64,259,799	V637A	probably benign	Het
Xpnpep1	C	A	19: 53,006,175	V341L	probably benign	Het
Yme1l1	A	G	2: 23,194,747	D619G	probably damaging	Het
Zfp597	G	A	16: 3,866,638	P85S	probably damaging	Het
Zscan20	A	G	4: 128,586,128	S857P	probably benign	Het

Other mutations in Cdc42bpa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00498:Cdc42bpa	APN	1	180106121	missense	probably damaging	1.00
IGL00807:Cdc42bpa	APN	1	180141453	missense	possibly damaging	0.88
IGL00972:Cdc42bpa	APN	1	180074684	missense	probably benign	0.00
IGL01084:Cdc42bpa	APN	1	180142274	splice site	probably benign
IGL01149:Cdc42bpa	APN	1	180074572	missense	probably damaging	0.99
IGL01377:Cdc42bpa	APN	1	180065143	missense	probably damaging	1.00
IGL01541:Cdc42bpa	APN	1	180151158	critical splice acceptor site	probably null
IGL01657:Cdc42bpa	APN	1	180111866	missense	probably benign	0.05
IGL01720:Cdc42bpa	APN	1	180111282	missense	probably damaging	1.00
IGL02227:Cdc42bpa	APN	1	180094424	missense	possibly damaging	0.64
IGL02234:Cdc42bpa	APN	1	180151191	nonsense	probably null
IGL02253:Cdc42bpa	APN	1	180031596	splice site	probably benign
IGL02587:Cdc42bpa	APN	1	180093945	missense	possibly damaging	0.91
IGL02671:Cdc42bpa	APN	1	180061822	missense	probably benign
IGL02746:Cdc42bpa	APN	1	180111747	missense	possibly damaging	0.91
IGL02756:Cdc42bpa	APN	1	180109259	missense	possibly damaging	0.77
IGL02994:Cdc42bpa	APN	1	179999437	missense	probably damaging	1.00
IGL03073:Cdc42bpa	APN	1	180094376	splice site	probably benign
IGL03295:Cdc42bpa	APN	1	180150204	missense	probably benign	0.00
P0022:Cdc42bpa	UTSW	1	179961276	missense	probably damaging	0.99
PIT4142001:Cdc42bpa	UTSW	1	180031560	missense	probably damaging	1.00
R0125:Cdc42bpa	UTSW	1	179961198	missense	probably damaging	1.00
R0268:Cdc42bpa	UTSW	1	180155782	intron	probably benign
R0472:Cdc42bpa	UTSW	1	180040179	missense	probably damaging	1.00
R0492:Cdc42bpa	UTSW	1	180101190	missense	probably benign	0.00
R0609:Cdc42bpa	UTSW	1	180040179	missense	probably damaging	1.00
R0691:Cdc42bpa	UTSW	1	180144835	missense	possibly damaging	0.91
R0738:Cdc42bpa	UTSW	1	179999462	splice site	probably benign
R1547:Cdc42bpa	UTSW	1	180074644	missense	probably damaging	0.99
R1553:Cdc42bpa	UTSW	1	180093975	missense	probably benign	0.01
R1601:Cdc42bpa	UTSW	1	180065001	nonsense	probably null
R1709:Cdc42bpa	UTSW	1	180067224	missense	probably damaging	1.00
R2101:Cdc42bpa	UTSW	1	180146968	missense	probably benign	0.39
R2279:Cdc42bpa	UTSW	1	180036919	missense	probably damaging	0.99
R2357:Cdc42bpa	UTSW	1	180067227	missense	possibly damaging	0.81
R2373:Cdc42bpa	UTSW	1	180111784	missense	possibly damaging	0.78
R2570:Cdc42bpa	UTSW	1	180150177	missense	possibly damaging	0.84
R3709:Cdc42bpa	UTSW	1	180065063	missense	probably damaging	1.00
R3710:Cdc42bpa	UTSW	1	180065063	missense	probably damaging	1.00
R3816:Cdc42bpa	UTSW	1	180144886	missense	possibly damaging	0.80
R3854:Cdc42bpa	UTSW	1	180155978	intron	probably benign
R3855:Cdc42bpa	UTSW	1	180155978	intron	probably benign
R3917:Cdc42bpa	UTSW	1	180106154	critical splice donor site	probably null
R4604:Cdc42bpa	UTSW	1	180109194	missense	probably benign	0.00
R4622:Cdc42bpa	UTSW	1	180074658	missense	probably damaging	0.98
R4664:Cdc42bpa	UTSW	1	180144565	missense	probably damaging	0.99
R4665:Cdc42bpa	UTSW	1	180144565	missense	probably damaging	0.99
R4887:Cdc42bpa	UTSW	1	180144635	missense	possibly damaging	0.61
R4989:Cdc42bpa	UTSW	1	180137801	missense	probably damaging	0.99
R5050:Cdc42bpa	UTSW	1	180072453	nonsense	probably null
R5077:Cdc42bpa	UTSW	1	180094533	intron	probably benign
R5196:Cdc42bpa	UTSW	1	180072413	missense	probably benign	0.09
R5276:Cdc42bpa	UTSW	1	180137850	missense	probably damaging	1.00
R5313:Cdc42bpa	UTSW	1	180084433	missense	probably benign
R5364:Cdc42bpa	UTSW	1	180067182	missense	probably benign	0.06
R5372:Cdc42bpa	UTSW	1	180064979	missense	probably damaging	1.00
R5405:Cdc42bpa	UTSW	1	180067329	missense	probably damaging	1.00
R5405:Cdc42bpa	UTSW	1	180138520	missense	possibly damaging	0.95
R5646:Cdc42bpa	UTSW	1	180106094	missense	probably damaging	0.99
R5713:Cdc42bpa	UTSW	1	180084410	missense	probably benign	0.03
R6012:Cdc42bpa	UTSW	1	180065090	missense	probably damaging	1.00
R6029:Cdc42bpa	UTSW	1	180111787	missense	probably damaging	1.00
R6378:Cdc42bpa	UTSW	1	180093996	missense	possibly damaging	0.91
R6609:Cdc42bpa	UTSW	1	180101274	critical splice donor site	probably null
R7122:Cdc42bpa	UTSW	1	180065018	missense	probably damaging	1.00
R7289:Cdc42bpa	UTSW	1	180061797	nonsense	probably null
R7670:Cdc42bpa	UTSW	1	180065081	missense	probably damaging	1.00
R7912:Cdc42bpa	UTSW	1	180094013	missense	probably damaging	1.00
R8139:Cdc42bpa	UTSW	1	180069319	missense	probably damaging	1.00
R8362:Cdc42bpa	UTSW	1	180162125	missense	probably damaging	0.98
R8378:Cdc42bpa	UTSW	1	180162144	missense	probably damaging	0.98
R8794:Cdc42bpa	UTSW	1	180067251	missense	probably damaging	1.00
R8835:Cdc42bpa	UTSW	1	180069351	missense	probably damaging	1.00
R8896:Cdc42bpa	UTSW	1	180130808	intron	probably benign
R9012:Cdc42bpa	UTSW	1	180031512	missense
R9110:Cdc42bpa	UTSW	1	180117693	missense	possibly damaging	0.67
R9178:Cdc42bpa	UTSW	1	180130836	missense
R9184:Cdc42bpa	UTSW	1	180144736	missense	probably benign	0.13
R9204:Cdc42bpa	UTSW	1	180111895	critical splice donor site	probably null
R9227:Cdc42bpa	UTSW	1	180106073	missense	probably benign
R9230:Cdc42bpa	UTSW	1	180106073	missense	probably benign
R9299:Cdc42bpa	UTSW	1	180144508	missense	probably damaging	1.00
R9366:Cdc42bpa	UTSW	1	180094110	missense	probably damaging	1.00
R9381:Cdc42bpa	UTSW	1	180141483	missense	probably damaging	0.97
R9461:Cdc42bpa	UTSW	1	180142296	missense	probably damaging	1.00
R9559:Cdc42bpa	UTSW	1	180111894	critical splice donor site	probably null
X0026:Cdc42bpa	UTSW	1	179961198	missense	probably damaging	1.00
Z1176:Cdc42bpa	UTSW	1	180065093	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTCCCTATATGCATTCAACTATAGT -3'
(R):5'- TCAGGAGCACTTCTCAACAAAATATAG -3'

Sequencing Primer
(F):5'- CGCCTACATACATACTGTATA -3'
(R):5'- CCCCTACTAATCAAAAAATATGAGT -3'

Posted On

2016-06-06