Mutagenetix > Incidental Mutations

Incidental Mutation 'R5033:Yme1l1'

389326

Institutional Source

Beutler Lab

Gene Symbol

Yme1l1

Ensembl Gene

ENSMUSG00000026775

Gene Name

YME1-like 1 (S. cerevisiae)

Synonyms

ATP-dependent metalloprotease FtsH1, Ftsh

MMRRC Submission

042624-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R5033 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23156369-23199260 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23194747 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 619 (D619G)

Ref Sequence

ENSEMBL: ENSMUSP00000028117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028117]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028117
AA Change: D619G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028117
Gene: ENSMUSG00000026775
AA Change: D619G

Domain	Start	End	E-Value	Type
AAA	313	450	4.77e-23	SMART
Pfam:Peptidase_M41	508	706	5.8e-77	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134342

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be involved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null embryos die prior to E13.5, and show a developmental delay from E8.5 to E12.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,279,414	V149A	probably benign	Het
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
4931406P16Rik	C	T	7: 34,245,812	G336S	probably benign	Het
9930111J21Rik1	G	A	11: 48,947,706	R685W	probably damaging	Het
Arhgap10	A	T	8: 77,382,757	L399H	probably damaging	Het
Arih2	AGCCG	AG	9: 108,611,660		probably benign	Het
Atp13a2	A	G	4: 141,000,821	H575R	possibly damaging	Het
Bbof1	G	A	12: 84,411,270		probably null	Het
Catsperg2	A	C	7: 29,710,134	Y545D	possibly damaging	Het
Cdc42bpa	T	A	1: 180,065,015	I248N	probably damaging	Het
Cdk11b	A	T	4: 155,648,825		probably benign	Het
Cfap46	C	A	7: 139,603,860	L90F	probably benign	Het
Cndp2	A	G	18: 84,670,829	L276P	possibly damaging	Het
Col3a1	A	C	1: 45,346,110	D129A	probably damaging	Het
Daam1	C	A	12: 71,946,520	H354Q	unknown	Het
Dnah5	T	A	15: 28,421,678	F3892Y	probably damaging	Het
Dnajb3	A	G	1: 88,205,023	V219A	possibly damaging	Het
Drd5	A	G	5: 38,320,201	H179R	probably damaging	Het
Dym	A	G	18: 75,119,161	N333D	possibly damaging	Het
Eif2b3	A	G	4: 117,052,736	D156G	probably damaging	Het
Emc1	A	G	4: 139,371,696	D830G	probably damaging	Het
F13a1	A	C	13: 36,988,856	I183M	probably damaging	Het
Fam136b-ps	T	A	15: 31,276,897		probably benign	Het
Fdft1	C	A	14: 63,163,404	K93N	probably damaging	Het
Gcc2	A	G	10: 58,278,806	D959G	probably damaging	Het
Gm14085	T	A	2: 122,522,914		probably null	Het
Gm853	C	T	4: 130,221,615		probably null	Het
Gp2	A	G	7: 119,454,291	V149A	probably damaging	Het
Gpc1	G	A	1: 92,857,029	G308D	probably damaging	Het
Hdac9	A	T	12: 34,373,907	C587S	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Iars2	A	G	1: 185,317,928	V453A	possibly damaging	Het
Il1r1	T	G	1: 40,293,524	C121W	probably damaging	Het
Jazf1	A	G	6: 52,777,540	Y184H	probably damaging	Het
Kel	A	T	6: 41,699,055	Y234N	probably damaging	Het
Khk	G	A	5: 30,929,660	G186D	probably damaging	Het
Klf4	A	T	4: 55,530,301	M270K	probably benign	Het
Kmt2c	G	A	5: 25,314,708	L2135F	probably benign	Het
Krtap15	A	G	16: 88,829,156	Y37C	probably damaging	Het
Lars	A	G	18: 42,214,776	F994S	possibly damaging	Het
Lrp8	T	C	4: 107,834,755		probably null	Het
Lrrc2	A	T	9: 110,980,919	D341V	probably damaging	Het
Map4k4	A	G	1: 40,007,502	K646R	probably damaging	Het
Mrps9	T	A	1: 42,895,331		probably null	Het
Olfr1130	T	A	2: 87,607,711	C108S	probably damaging	Het
Olfr745	T	A	14: 50,643,162	Y288N	probably damaging	Het
Olfr898	C	T	9: 38,349,628	H176Y	probably damaging	Het
Pcnt	A	T	10: 76,399,945	C1401S	possibly damaging	Het
Pdgfrb	A	T	18: 61,077,668	K749M	probably damaging	Het
Pigo	A	T	4: 43,019,412	W969R	probably null	Het
Pigr	A	T	1: 130,844,699	Y218F	probably damaging	Het
Pih1d1	A	G	7: 45,154,854		probably benign	Het
Pik3cg	A	T	12: 32,199,196		probably null	Het
Pik3r6	A	T	11: 68,533,468	K300*	probably null	Het
Pip5k1c	A	G	10: 81,305,250	D64G	probably damaging	Het
Piwil2	A	T	14: 70,421,593	I161K	possibly damaging	Het
Pou3f1	A	G	4: 124,658,656	E317G	probably damaging	Het
Prdm8	C	T	5: 98,185,212	Q213*	probably null	Het
Prpf6	T	A	2: 181,650,106	C739S	possibly damaging	Het
Psmc3	T	A	2: 91,054,608	S40T	probably benign	Het
Psmd3	A	T	11: 98,682,824	D32V	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rapgef6	A	T	11: 54,691,381	H1373L	possibly damaging	Het
Rnf207	A	C	4: 152,313,209	S328A	probably benign	Het
Ros1	C	T	10: 52,128,416		probably null	Het
Ryr2	T	A	13: 11,587,254	I4581F	possibly damaging	Het
Sacm1l	C	T	9: 123,586,399	R480W	probably damaging	Het
Sec16a	A	G	2: 26,419,649	V664A	probably benign	Het
Selenoo	T	A	15: 89,092,766	M207K	probably damaging	Het
Sh3tc2	G	A	18: 62,014,891		probably null	Het
Slco2b1	G	T	7: 99,660,049	Q692K	probably benign	Het
Slfn4	A	T	11: 83,186,797	D137V	probably damaging	Het
Srrm2	G	A	17: 23,820,618	A2175T	probably damaging	Het
Stard9	T	A	2: 120,693,399	C692S	probably benign	Het
Sulf2	T	A	2: 166,081,622	D559V	probably benign	Het
Tbpl2	T	C	2: 24,087,158	I283V	probably benign	Het
Tmem19	A	G	10: 115,359,761	F46S	probably benign	Het
Trp63	T	A	16: 25,763,306	Y35N	probably damaging	Het
Ttn	T	A	2: 76,886,442		probably benign	Het
Ube2z	A	T	11: 96,050,322	H331Q	probably benign	Het
Ubr1	C	T	2: 120,911,997		probably null	Het
Uhrf1bp1	A	G	17: 27,886,864	E788G	probably damaging	Het
Vmn1r235	A	T	17: 21,262,288	I292F	possibly damaging	Het
Vmn2r1	T	A	3: 64,105,080	D787E	probably damaging	Het
Vmn2r3	A	G	3: 64,259,799	V637A	probably benign	Het
Xpnpep1	C	A	19: 53,006,175	V341L	probably benign	Het
Zfp597	G	A	16: 3,866,638	P85S	probably damaging	Het
Zscan20	A	G	4: 128,586,128	S857P	probably benign	Het

Other mutations in Yme1l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Yme1l1	APN	2	23192500	missense	probably benign	0.00
IGL01764:Yme1l1	APN	2	23162544	missense	probably benign	0.00
IGL03289:Yme1l1	APN	2	23160268	missense	probably benign
R0043:Yme1l1	UTSW	2	23187803	missense	probably damaging	0.97
R0540:Yme1l1	UTSW	2	23192515	missense	possibly damaging	0.68
R0583:Yme1l1	UTSW	2	23186250	missense	probably damaging	1.00
R0661:Yme1l1	UTSW	2	23191042	missense	probably damaging	0.96
R0673:Yme1l1	UTSW	2	23168288	missense	probably benign	0.03
R2154:Yme1l1	UTSW	2	23162508	missense	probably damaging	0.99
R2241:Yme1l1	UTSW	2	23196900	nonsense	probably null
R2270:Yme1l1	UTSW	2	23175220	missense	possibly damaging	0.53
R2345:Yme1l1	UTSW	2	23194786	missense	probably damaging	1.00
R3837:Yme1l1	UTSW	2	23191080	missense	possibly damaging	0.69
R4344:Yme1l1	UTSW	2	23173061	missense	probably benign	0.02
R4368:Yme1l1	UTSW	2	23160211	missense	possibly damaging	0.81
R4412:Yme1l1	UTSW	2	23175187	missense	probably damaging	1.00
R4470:Yme1l1	UTSW	2	23186332	critical splice donor site	probably null
R4472:Yme1l1	UTSW	2	23186332	critical splice donor site	probably null
R4934:Yme1l1	UTSW	2	23168321	nonsense	probably null
R5388:Yme1l1	UTSW	2	23162557	missense	probably benign	0.01
R5389:Yme1l1	UTSW	2	23193234	missense	probably damaging	1.00
R5943:Yme1l1	UTSW	2	23168330	missense	probably damaging	0.96
R5947:Yme1l1	UTSW	2	23195306	intron	probably benign
R6243:Yme1l1	UTSW	2	23193172	missense	probably benign	0.00
R6724:Yme1l1	UTSW	2	23194762	missense	probably damaging	1.00
R6891:Yme1l1	UTSW	2	23195389	missense	probably damaging	0.99
R7016:Yme1l1	UTSW	2	23186355	splice site	probably null
R7565:Yme1l1	UTSW	2	23160220	missense	possibly damaging	0.88
R7589:Yme1l1	UTSW	2	23160262	missense	probably benign	0.01
R7751:Yme1l1	UTSW	2	23187844	critical splice donor site	probably null
R7871:Yme1l1	UTSW	2	23181065	missense	probably damaging	1.00
R7909:Yme1l1	UTSW	2	23194757	missense	probably benign	0.00
R8203:Yme1l1	UTSW	2	23164526	missense	probably benign	0.00
R8329:Yme1l1	UTSW	2	23164585	nonsense	probably null
R8474:Yme1l1	UTSW	2	23162572	missense	probably benign
R8746:Yme1l1	UTSW	2	23162531	missense	probably benign	0.05
Z1176:Yme1l1	UTSW	2	23162517	missense	probably damaging	0.96
Z1176:Yme1l1	UTSW	2	23193184	missense	probably damaging	0.98
Z1177:Yme1l1	UTSW	2	23186877	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TCACTGTTGCCTGAGAATGAC -3'
(R):5'- CTAGTCAGAGCAGTGCTTAGAATAAG -3'

Sequencing Primer
(F):5'- AGCTGCTTGCACAGATGG -3'
(R):5'- AGCAGTGCTTAGAATAAGTCATAATC -3'

Posted On

2016-06-06