Incidental Mutation 'R5033:Stard9'
ID389332
Institutional Source Beutler Lab
Gene Symbol Stard9
Ensembl Gene ENSMUSG00000033705
Gene NameSTART domain containing 9
SynonymsE230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin
MMRRC Submission 042624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5033 (G1)
Quality Score212
Status Not validated
Chromosome2
Chromosomal Location120629121-120731895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120693399 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 692 (C692S)
Ref Sequence ENSEMBL: ENSMUSP00000136055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000180041]
Predicted Effect probably benign
Transcript: ENSMUST00000140843
SMART Domains Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

DomainStartEndE-ValueType
FHA 63 115 2.8e-4 SMART
coiled coil region 334 354 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
low complexity region 866 871 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1765 1775 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2953 2963 N/A INTRINSIC
low complexity region 3269 3281 N/A INTRINSIC
low complexity region 3421 3435 N/A INTRINSIC
coiled coil region 3767 3808 N/A INTRINSIC
low complexity region 3812 3821 N/A INTRINSIC
low complexity region 3827 3844 N/A INTRINSIC
low complexity region 3904 3925 N/A INTRINSIC
SCOP:d1jssa_ 3946 4142 1e-28 SMART
Blast:START 3947 4143 1e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000180041
AA Change: C692S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: C692S

DomainStartEndE-ValueType
KISc 1 392 3.31e-143 SMART
low complexity region 398 409 N/A INTRINSIC
FHA 481 533 2.8e-4 SMART
coiled coil region 752 772 N/A INTRINSIC
low complexity region 991 1002 N/A INTRINSIC
low complexity region 1284 1289 N/A INTRINSIC
low complexity region 1441 1453 N/A INTRINSIC
low complexity region 1652 1666 N/A INTRINSIC
low complexity region 2183 2193 N/A INTRINSIC
low complexity region 2964 2977 N/A INTRINSIC
low complexity region 3371 3381 N/A INTRINSIC
low complexity region 3687 3699 N/A INTRINSIC
low complexity region 3839 3853 N/A INTRINSIC
coiled coil region 4185 4226 N/A INTRINSIC
low complexity region 4230 4239 N/A INTRINSIC
low complexity region 4245 4262 N/A INTRINSIC
low complexity region 4322 4343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,279,414 V149A probably benign Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4931406P16Rik C T 7: 34,245,812 G336S probably benign Het
9930111J21Rik1 G A 11: 48,947,706 R685W probably damaging Het
Arhgap10 A T 8: 77,382,757 L399H probably damaging Het
Arih2 AGCCG AG 9: 108,611,660 probably benign Het
Atp13a2 A G 4: 141,000,821 H575R possibly damaging Het
Bbof1 G A 12: 84,411,270 probably null Het
Catsperg2 A C 7: 29,710,134 Y545D possibly damaging Het
Cdc42bpa T A 1: 180,065,015 I248N probably damaging Het
Cdk11b A T 4: 155,648,825 probably benign Het
Cfap46 C A 7: 139,603,860 L90F probably benign Het
Cndp2 A G 18: 84,670,829 L276P possibly damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Daam1 C A 12: 71,946,520 H354Q unknown Het
Dnah5 T A 15: 28,421,678 F3892Y probably damaging Het
Dnajb3 A G 1: 88,205,023 V219A possibly damaging Het
Drd5 A G 5: 38,320,201 H179R probably damaging Het
Dym A G 18: 75,119,161 N333D possibly damaging Het
Eif2b3 A G 4: 117,052,736 D156G probably damaging Het
Emc1 A G 4: 139,371,696 D830G probably damaging Het
F13a1 A C 13: 36,988,856 I183M probably damaging Het
Fam136b-ps T A 15: 31,276,897 probably benign Het
Fdft1 C A 14: 63,163,404 K93N probably damaging Het
Gcc2 A G 10: 58,278,806 D959G probably damaging Het
Gm14085 T A 2: 122,522,914 probably null Het
Gm853 C T 4: 130,221,615 probably null Het
Gp2 A G 7: 119,454,291 V149A probably damaging Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Hdac9 A T 12: 34,373,907 C587S probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Iars2 A G 1: 185,317,928 V453A possibly damaging Het
Il1r1 T G 1: 40,293,524 C121W probably damaging Het
Jazf1 A G 6: 52,777,540 Y184H probably damaging Het
Kel A T 6: 41,699,055 Y234N probably damaging Het
Khk G A 5: 30,929,660 G186D probably damaging Het
Klf4 A T 4: 55,530,301 M270K probably benign Het
Kmt2c G A 5: 25,314,708 L2135F probably benign Het
Krtap15 A G 16: 88,829,156 Y37C probably damaging Het
Lars A G 18: 42,214,776 F994S possibly damaging Het
Lrp8 T C 4: 107,834,755 probably null Het
Lrrc2 A T 9: 110,980,919 D341V probably damaging Het
Map4k4 A G 1: 40,007,502 K646R probably damaging Het
Mrps9 T A 1: 42,895,331 probably null Het
Olfr1130 T A 2: 87,607,711 C108S probably damaging Het
Olfr745 T A 14: 50,643,162 Y288N probably damaging Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pcnt A T 10: 76,399,945 C1401S possibly damaging Het
Pdgfrb A T 18: 61,077,668 K749M probably damaging Het
Pigo A T 4: 43,019,412 W969R probably null Het
Pigr A T 1: 130,844,699 Y218F probably damaging Het
Pih1d1 A G 7: 45,154,854 probably benign Het
Pik3cg A T 12: 32,199,196 probably null Het
Pik3r6 A T 11: 68,533,468 K300* probably null Het
Pip5k1c A G 10: 81,305,250 D64G probably damaging Het
Piwil2 A T 14: 70,421,593 I161K possibly damaging Het
Pou3f1 A G 4: 124,658,656 E317G probably damaging Het
Prdm8 C T 5: 98,185,212 Q213* probably null Het
Prpf6 T A 2: 181,650,106 C739S possibly damaging Het
Psmc3 T A 2: 91,054,608 S40T probably benign Het
Psmd3 A T 11: 98,682,824 D32V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rapgef6 A T 11: 54,691,381 H1373L possibly damaging Het
Rnf207 A C 4: 152,313,209 S328A probably benign Het
Ros1 C T 10: 52,128,416 probably null Het
Ryr2 T A 13: 11,587,254 I4581F possibly damaging Het
Sacm1l C T 9: 123,586,399 R480W probably damaging Het
Sec16a A G 2: 26,419,649 V664A probably benign Het
Selenoo T A 15: 89,092,766 M207K probably damaging Het
Sh3tc2 G A 18: 62,014,891 probably null Het
Slco2b1 G T 7: 99,660,049 Q692K probably benign Het
Slfn4 A T 11: 83,186,797 D137V probably damaging Het
Srrm2 G A 17: 23,820,618 A2175T probably damaging Het
Sulf2 T A 2: 166,081,622 D559V probably benign Het
Tbpl2 T C 2: 24,087,158 I283V probably benign Het
Tmem19 A G 10: 115,359,761 F46S probably benign Het
Trp63 T A 16: 25,763,306 Y35N probably damaging Het
Ttn T A 2: 76,886,442 probably benign Het
Ube2z A T 11: 96,050,322 H331Q probably benign Het
Ubr1 C T 2: 120,911,997 probably null Het
Uhrf1bp1 A G 17: 27,886,864 E788G probably damaging Het
Vmn1r235 A T 17: 21,262,288 I292F possibly damaging Het
Vmn2r1 T A 3: 64,105,080 D787E probably damaging Het
Vmn2r3 A G 3: 64,259,799 V637A probably benign Het
Xpnpep1 C A 19: 53,006,175 V341L probably benign Het
Yme1l1 A G 2: 23,194,747 D619G probably damaging Het
Zfp597 G A 16: 3,866,638 P85S probably damaging Het
Zscan20 A G 4: 128,586,128 S857P probably benign Het
Other mutations in Stard9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Stard9 APN 2 120701847 missense possibly damaging 0.52
IGL01122:Stard9 APN 2 120698479 missense possibly damaging 0.93
IGL01318:Stard9 APN 2 120698719 missense possibly damaging 0.56
IGL01371:Stard9 APN 2 120701368 missense probably benign 0.04
IGL01394:Stard9 APN 2 120706327 missense possibly damaging 0.78
IGL01531:Stard9 APN 2 120673604 missense possibly damaging 0.93
IGL01721:Stard9 APN 2 120703330 missense probably damaging 1.00
IGL01810:Stard9 APN 2 120699084 missense possibly damaging 0.95
IGL01829:Stard9 APN 2 120706446 missense possibly damaging 0.59
IGL01916:Stard9 APN 2 120668016 missense probably damaging 1.00
IGL02031:Stard9 APN 2 120702339 missense probably benign 0.27
IGL02081:Stard9 APN 2 120664910 missense probably damaging 0.98
IGL02558:Stard9 APN 2 120696907 missense possibly damaging 0.95
IGL02646:Stard9 APN 2 120698992 missense probably damaging 1.00
IGL02873:Stard9 APN 2 120713807 missense probably damaging 1.00
IGL03195:Stard9 APN 2 120705802 missense probably damaging 1.00
IGL03204:Stard9 APN 2 120705802 missense probably damaging 1.00
FR4737:Stard9 UTSW 2 120696085 small insertion probably benign
IGL03014:Stard9 UTSW 2 120702194 unclassified probably benign
PIT4151001:Stard9 UTSW 2 120702756 nonsense probably null
PIT4498001:Stard9 UTSW 2 120697435 missense possibly damaging 0.86
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0027:Stard9 UTSW 2 120703501 missense probably benign
R0038:Stard9 UTSW 2 120695832 missense probably benign
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0049:Stard9 UTSW 2 120699819 missense probably damaging 1.00
R0116:Stard9 UTSW 2 120634255 missense probably damaging 0.99
R0398:Stard9 UTSW 2 120696307 missense probably benign 0.03
R0479:Stard9 UTSW 2 120697596 missense probably damaging 1.00
R0556:Stard9 UTSW 2 120698923 missense probably benign 0.09
R0589:Stard9 UTSW 2 120698547 missense probably benign 0.00
R0609:Stard9 UTSW 2 120706306 missense probably damaging 1.00
R0611:Stard9 UTSW 2 120699257 missense probably benign 0.00
R0683:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0751:Stard9 UTSW 2 120697485 missense probably benign 0.04
R0833:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0836:Stard9 UTSW 2 120696999 missense possibly damaging 0.86
R0838:Stard9 UTSW 2 120700842 missense probably damaging 1.00
R0848:Stard9 UTSW 2 120695823 missense probably damaging 1.00
R0849:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R0961:Stard9 UTSW 2 120693439 missense probably benign 0.01
R0993:Stard9 UTSW 2 120705169 missense probably damaging 1.00
R1005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1006:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1115:Stard9 UTSW 2 120692850 missense probably benign 0.05
R1163:Stard9 UTSW 2 120696213 missense possibly damaging 0.86
R1199:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1200:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1331:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1332:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1333:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1334:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1335:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1336:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1338:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1346:Stard9 UTSW 2 120713448 missense probably damaging 1.00
R1370:Stard9 UTSW 2 120697477 missense probably benign 0.11
R1384:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1401:Stard9 UTSW 2 120712847 splice site probably benign
R1416:Stard9 UTSW 2 120700972 missense probably benign 0.00
R1453:Stard9 UTSW 2 120666376 missense probably damaging 1.00
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1468:Stard9 UTSW 2 120703197 missense possibly damaging 0.90
R1525:Stard9 UTSW 2 120702052 missense probably benign 0.09
R1538:Stard9 UTSW 2 120696711 missense probably benign 0.25
R1614:Stard9 UTSW 2 120697675 missense possibly damaging 0.95
R1654:Stard9 UTSW 2 120703722 missense probably benign 0.37
R1658:Stard9 UTSW 2 120701542 missense probably benign 0.02
R1686:Stard9 UTSW 2 120699492 missense probably benign 0.00
R1797:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1803:Stard9 UTSW 2 120701489 missense probably benign 0.24
R1806:Stard9 UTSW 2 120679453 splice site probably null
R1847:Stard9 UTSW 2 120698489 missense possibly damaging 0.51
R1853:Stard9 UTSW 2 120688751 missense probably damaging 1.00
R1892:Stard9 UTSW 2 120693708 missense probably benign 0.01
R1906:Stard9 UTSW 2 120696427 missense probably benign 0.00
R1907:Stard9 UTSW 2 120713812 missense probably damaging 1.00
R1930:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R1933:Stard9 UTSW 2 120698656 missense possibly damaging 0.55
R1989:Stard9 UTSW 2 120701406 missense probably benign
R1999:Stard9 UTSW 2 120692868 missense probably damaging 0.99
R2004:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2005:Stard9 UTSW 2 120664945 missense possibly damaging 0.90
R2005:Stard9 UTSW 2 120673636 missense probably damaging 1.00
R2021:Stard9 UTSW 2 120704235 missense probably benign 0.05
R2025:Stard9 UTSW 2 120702398 missense probably benign 0.20
R2190:Stard9 UTSW 2 120714120 missense probably benign 0.22
R2204:Stard9 UTSW 2 120698531 frame shift probably null
R2422:Stard9 UTSW 2 120700284 missense probably benign 0.29
R3401:Stard9 UTSW 2 120703689 missense probably damaging 0.98
R3618:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3619:Stard9 UTSW 2 120699019 missense possibly damaging 0.49
R3900:Stard9 UTSW 2 120713549 missense possibly damaging 0.93
R3943:Stard9 UTSW 2 120698229 missense probably benign 0.11
R4022:Stard9 UTSW 2 120704155 missense probably benign 0.05
R4223:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4224:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4225:Stard9 UTSW 2 120664991 missense possibly damaging 0.95
R4345:Stard9 UTSW 2 120701946 missense probably benign 0.43
R4382:Stard9 UTSW 2 120634222 missense probably damaging 1.00
R4453:Stard9 UTSW 2 120697791 missense probably benign
R4499:Stard9 UTSW 2 120700241 missense probably benign 0.05
R4524:Stard9 UTSW 2 120696445 missense probably damaging 1.00
R4671:Stard9 UTSW 2 120698640 missense probably damaging 0.98
R4701:Stard9 UTSW 2 120705713 missense possibly damaging 0.85
R4744:Stard9 UTSW 2 120696123 missense probably benign 0.01
R4822:Stard9 UTSW 2 120695941 missense possibly damaging 0.94
R4847:Stard9 UTSW 2 120703113 missense probably benign 0.18
R4863:Stard9 UTSW 2 120700860 missense probably benign 0.00
R4898:Stard9 UTSW 2 120706419 nonsense probably null
R5087:Stard9 UTSW 2 120697019 nonsense probably null
R5157:Stard9 UTSW 2 120697861 missense probably benign
R5213:Stard9 UTSW 2 120699226 missense probably damaging 1.00
R5237:Stard9 UTSW 2 120699358 missense probably damaging 0.96
R5257:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5258:Stard9 UTSW 2 120699343 missense probably damaging 0.99
R5273:Stard9 UTSW 2 120705087 missense possibly damaging 0.94
R5286:Stard9 UTSW 2 120701947 missense probably benign 0.43
R5288:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5292:Stard9 UTSW 2 120699145 missense probably benign 0.17
R5328:Stard9 UTSW 2 120699230 missense probably damaging 1.00
R5385:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5386:Stard9 UTSW 2 120700630 missense probably damaging 0.98
R5393:Stard9 UTSW 2 120702906 missense possibly damaging 0.87
R5405:Stard9 UTSW 2 120693668 missense probably benign 0.17
R5685:Stard9 UTSW 2 120705322 missense probably damaging 1.00
R5749:Stard9 UTSW 2 120703786 missense probably damaging 1.00
R5780:Stard9 UTSW 2 120703396 missense probably benign 0.02
R5901:Stard9 UTSW 2 120701370 missense probably damaging 1.00
R5941:Stard9 UTSW 2 120713558 missense probably damaging 1.00
R5960:Stard9 UTSW 2 120699961 missense probably benign 0.05
R5966:Stard9 UTSW 2 120697099 missense probably damaging 1.00
R5967:Stard9 UTSW 2 120706894 missense probably damaging 0.99
R6012:Stard9 UTSW 2 120704586 missense probably damaging 1.00
R6019:Stard9 UTSW 2 120693715 frame shift probably null
R6020:Stard9 UTSW 2 120693715 frame shift probably null
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6036:Stard9 UTSW 2 120700075 missense probably benign 0.09
R6090:Stard9 UTSW 2 120693654 missense probably damaging 0.99
R6192:Stard9 UTSW 2 120696760 missense probably damaging 0.99
R6228:Stard9 UTSW 2 120713750 missense probably damaging 1.00
R6235:Stard9 UTSW 2 120713546 missense probably damaging 1.00
R6280:Stard9 UTSW 2 120701127 missense probably benign
R6338:Stard9 UTSW 2 120697485 missense probably benign
R6344:Stard9 UTSW 2 120704320 missense probably benign 0.12
R6364:Stard9 UTSW 2 120713429 missense probably damaging 1.00
R6383:Stard9 UTSW 2 120666407 critical splice donor site probably null
R6644:Stard9 UTSW 2 120695772 missense probably benign 0.11
R6747:Stard9 UTSW 2 120698383 missense possibly damaging 0.62
R6833:Stard9 UTSW 2 120701259 missense probably damaging 1.00
R6836:Stard9 UTSW 2 120699843 missense probably benign 0.15
R6861:Stard9 UTSW 2 120705186 missense probably benign 0.09
R6872:Stard9 UTSW 2 120714068 nonsense probably null
R6875:Stard9 UTSW 2 120697436 missense probably benign 0.04
R6915:Stard9 UTSW 2 120702630 missense probably benign 0.00
R6934:Stard9 UTSW 2 120697695 missense probably benign 0.00
R6943:Stard9 UTSW 2 120702196 missense probably benign 0.29
R7009:Stard9 UTSW 2 120697191 missense probably benign 0.37
R7031:Stard9 UTSW 2 120700450 missense possibly damaging 0.61
R7132:Stard9 UTSW 2 120679378 nonsense probably null
R7151:Stard9 UTSW 2 120696142 missense probably benign
R7154:Stard9 UTSW 2 120701314 missense probably benign 0.00
R7154:Stard9 UTSW 2 120704542 missense probably benign 0.02
R7165:Stard9 UTSW 2 120704158 missense probably damaging 1.00
R7260:Stard9 UTSW 2 120706938 missense possibly damaging 0.90
R7270:Stard9 UTSW 2 120634274 nonsense probably null
R7282:Stard9 UTSW 2 120698503 missense probably benign 0.00
R7344:Stard9 UTSW 2 120704686 missense possibly damaging 0.90
R7347:Stard9 UTSW 2 120666534 missense probably benign
R7359:Stard9 UTSW 2 120698280 missense probably damaging 1.00
R7410:Stard9 UTSW 2 120701497 missense probably benign 0.41
R7422:Stard9 UTSW 2 120702152 missense probably benign 0.21
R7475:Stard9 UTSW 2 120688110 missense probably damaging 1.00
R7523:Stard9 UTSW 2 120699597 missense probably benign
R7553:Stard9 UTSW 2 120693808 splice site probably null
R7624:Stard9 UTSW 2 120688146 missense probably benign 0.15
X0023:Stard9 UTSW 2 120702744 missense probably benign 0.00
X0023:Stard9 UTSW 2 120702963 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTCCTTTCCCTGCAGTGAGG -3'
(R):5'- TACTGAGCTGCTCCAGTCTC -3'

Sequencing Primer
(F):5'- TGAGGAGGCCCTGTAGCTTC -3'
(R):5'- AGCTGGAATGATACCTTTTTCTGC -3'
Posted On2016-06-06