Incidental Mutation 'R5033:Ubr1'
ID389333
Institutional Source Beutler Lab
Gene Symbol Ubr1
Ensembl Gene ENSMUSG00000027272
Gene Nameubiquitin protein ligase E3 component n-recognin 1
SynonymsE3 alpha
MMRRC Submission 042624-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.781) question?
Stock #R5033 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120860269-120970715 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 120911997 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028728]
Predicted Effect probably null
Transcript: ENSMUST00000028728
SMART Domains Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272

DomainStartEndE-ValueType
ZnF_UBR1 97 167 1.24e-35 SMART
Pfam:ClpS 221 301 8e-24 PFAM
low complexity region 918 936 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
low complexity region 1070 1081 N/A INTRINSIC
Blast:RING 1101 1203 4e-34 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129790
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,279,414 V149A probably benign Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4931406P16Rik C T 7: 34,245,812 G336S probably benign Het
9930111J21Rik1 G A 11: 48,947,706 R685W probably damaging Het
Arhgap10 A T 8: 77,382,757 L399H probably damaging Het
Arih2 AGCCG AG 9: 108,611,660 probably benign Het
Atp13a2 A G 4: 141,000,821 H575R possibly damaging Het
Bbof1 G A 12: 84,411,270 probably null Het
Catsperg2 A C 7: 29,710,134 Y545D possibly damaging Het
Cdc42bpa T A 1: 180,065,015 I248N probably damaging Het
Cdk11b A T 4: 155,648,825 probably benign Het
Cfap46 C A 7: 139,603,860 L90F probably benign Het
Cndp2 A G 18: 84,670,829 L276P possibly damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Daam1 C A 12: 71,946,520 H354Q unknown Het
Dnah5 T A 15: 28,421,678 F3892Y probably damaging Het
Dnajb3 A G 1: 88,205,023 V219A possibly damaging Het
Drd5 A G 5: 38,320,201 H179R probably damaging Het
Dym A G 18: 75,119,161 N333D possibly damaging Het
Eif2b3 A G 4: 117,052,736 D156G probably damaging Het
Emc1 A G 4: 139,371,696 D830G probably damaging Het
F13a1 A C 13: 36,988,856 I183M probably damaging Het
Fam136b-ps T A 15: 31,276,897 probably benign Het
Fdft1 C A 14: 63,163,404 K93N probably damaging Het
Gcc2 A G 10: 58,278,806 D959G probably damaging Het
Gm14085 T A 2: 122,522,914 probably null Het
Gm853 C T 4: 130,221,615 probably null Het
Gp2 A G 7: 119,454,291 V149A probably damaging Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Hdac9 A T 12: 34,373,907 C587S probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Iars2 A G 1: 185,317,928 V453A possibly damaging Het
Il1r1 T G 1: 40,293,524 C121W probably damaging Het
Jazf1 A G 6: 52,777,540 Y184H probably damaging Het
Kel A T 6: 41,699,055 Y234N probably damaging Het
Khk G A 5: 30,929,660 G186D probably damaging Het
Klf4 A T 4: 55,530,301 M270K probably benign Het
Kmt2c G A 5: 25,314,708 L2135F probably benign Het
Krtap15 A G 16: 88,829,156 Y37C probably damaging Het
Lars A G 18: 42,214,776 F994S possibly damaging Het
Lrp8 T C 4: 107,834,755 probably null Het
Lrrc2 A T 9: 110,980,919 D341V probably damaging Het
Map4k4 A G 1: 40,007,502 K646R probably damaging Het
Mrps9 T A 1: 42,895,331 probably null Het
Olfr1130 T A 2: 87,607,711 C108S probably damaging Het
Olfr745 T A 14: 50,643,162 Y288N probably damaging Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pcnt A T 10: 76,399,945 C1401S possibly damaging Het
Pdgfrb A T 18: 61,077,668 K749M probably damaging Het
Pigo A T 4: 43,019,412 W969R probably null Het
Pigr A T 1: 130,844,699 Y218F probably damaging Het
Pih1d1 A G 7: 45,154,854 probably benign Het
Pik3cg A T 12: 32,199,196 probably null Het
Pik3r6 A T 11: 68,533,468 K300* probably null Het
Pip5k1c A G 10: 81,305,250 D64G probably damaging Het
Piwil2 A T 14: 70,421,593 I161K possibly damaging Het
Pou3f1 A G 4: 124,658,656 E317G probably damaging Het
Prdm8 C T 5: 98,185,212 Q213* probably null Het
Prpf6 T A 2: 181,650,106 C739S possibly damaging Het
Psmc3 T A 2: 91,054,608 S40T probably benign Het
Psmd3 A T 11: 98,682,824 D32V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rapgef6 A T 11: 54,691,381 H1373L possibly damaging Het
Rnf207 A C 4: 152,313,209 S328A probably benign Het
Ros1 C T 10: 52,128,416 probably null Het
Ryr2 T A 13: 11,587,254 I4581F possibly damaging Het
Sacm1l C T 9: 123,586,399 R480W probably damaging Het
Sec16a A G 2: 26,419,649 V664A probably benign Het
Selenoo T A 15: 89,092,766 M207K probably damaging Het
Sh3tc2 G A 18: 62,014,891 probably null Het
Slco2b1 G T 7: 99,660,049 Q692K probably benign Het
Slfn4 A T 11: 83,186,797 D137V probably damaging Het
Srrm2 G A 17: 23,820,618 A2175T probably damaging Het
Stard9 T A 2: 120,693,399 C692S probably benign Het
Sulf2 T A 2: 166,081,622 D559V probably benign Het
Tbpl2 T C 2: 24,087,158 I283V probably benign Het
Tmem19 A G 10: 115,359,761 F46S probably benign Het
Trp63 T A 16: 25,763,306 Y35N probably damaging Het
Ttn T A 2: 76,886,442 probably benign Het
Ube2z A T 11: 96,050,322 H331Q probably benign Het
Uhrf1bp1 A G 17: 27,886,864 E788G probably damaging Het
Vmn1r235 A T 17: 21,262,288 I292F possibly damaging Het
Vmn2r1 T A 3: 64,105,080 D787E probably damaging Het
Vmn2r3 A G 3: 64,259,799 V637A probably benign Het
Xpnpep1 C A 19: 53,006,175 V341L probably benign Het
Yme1l1 A G 2: 23,194,747 D619G probably damaging Het
Zfp597 G A 16: 3,866,638 P85S probably damaging Het
Zscan20 A G 4: 128,586,128 S857P probably benign Het
Other mutations in Ubr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ubr1 APN 2 120875407 missense possibly damaging 0.65
IGL00570:Ubr1 APN 2 120941093 missense possibly damaging 0.93
IGL00990:Ubr1 APN 2 120930872 missense probably damaging 1.00
IGL01124:Ubr1 APN 2 120914905 missense probably benign
IGL01346:Ubr1 APN 2 120873122 critical splice donor site probably null
IGL01368:Ubr1 APN 2 120941131 splice site probably benign
IGL01539:Ubr1 APN 2 120926013 missense possibly damaging 0.79
IGL01862:Ubr1 APN 2 120934342 missense possibly damaging 0.81
IGL01965:Ubr1 APN 2 120875398 missense probably damaging 0.99
IGL01984:Ubr1 APN 2 120921386 missense probably damaging 0.99
IGL02184:Ubr1 APN 2 120900508 missense probably benign 0.00
IGL02208:Ubr1 APN 2 120946349 missense probably benign 0.00
IGL02415:Ubr1 APN 2 120970603 utr 5 prime probably benign
IGL02517:Ubr1 APN 2 120864373 missense possibly damaging 0.69
IGL02614:Ubr1 APN 2 120870979 splice site probably benign
IGL02627:Ubr1 APN 2 120940991 missense probably damaging 1.00
IGL02718:Ubr1 APN 2 120914883 missense probably damaging 1.00
IGL02741:Ubr1 APN 2 120941091 missense probably benign 0.01
IGL02939:Ubr1 APN 2 120881183 critical splice acceptor site probably null
IGL03081:Ubr1 APN 2 120961156 missense possibly damaging 0.83
IGL03310:Ubr1 APN 2 120864417 missense probably damaging 1.00
IGL03370:Ubr1 APN 2 120895160 missense probably benign
I1329:Ubr1 UTSW 2 120934294 splice site probably benign
R0022:Ubr1 UTSW 2 120961173 splice site probably benign
R0345:Ubr1 UTSW 2 120904103 splice site probably null
R0373:Ubr1 UTSW 2 120946657 missense probably benign 0.01
R0393:Ubr1 UTSW 2 120906946 missense probably damaging 1.00
R0543:Ubr1 UTSW 2 120881093 missense probably damaging 1.00
R0559:Ubr1 UTSW 2 120947883 nonsense probably null
R0723:Ubr1 UTSW 2 120881101 nonsense probably null
R1178:Ubr1 UTSW 2 120926029 nonsense probably null
R1401:Ubr1 UTSW 2 120955644 missense probably benign 0.01
R1485:Ubr1 UTSW 2 120961098 missense probably benign 0.03
R1572:Ubr1 UTSW 2 120935319 splice site probably benign
R1920:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1921:Ubr1 UTSW 2 120930968 missense probably benign 0.11
R1997:Ubr1 UTSW 2 120946273 critical splice donor site probably null
R2129:Ubr1 UTSW 2 120942553 missense probably benign 0.35
R2147:Ubr1 UTSW 2 120864330 missense probably damaging 1.00
R2191:Ubr1 UTSW 2 120926047 missense probably damaging 0.96
R2288:Ubr1 UTSW 2 120909482 missense probably damaging 1.00
R3409:Ubr1 UTSW 2 120963448 missense probably benign 0.02
R3930:Ubr1 UTSW 2 120916470 missense probably benign 0.20
R3979:Ubr1 UTSW 2 120862687 missense probably benign 0.11
R4172:Ubr1 UTSW 2 120946622 splice site probably null
R4173:Ubr1 UTSW 2 120946622 splice site probably null
R4174:Ubr1 UTSW 2 120946622 splice site probably null
R4241:Ubr1 UTSW 2 120934386 missense possibly damaging 0.69
R4366:Ubr1 UTSW 2 120970603 utr 5 prime probably benign
R4371:Ubr1 UTSW 2 120895066 splice site probably null
R4449:Ubr1 UTSW 2 120946381 missense possibly damaging 0.84
R4533:Ubr1 UTSW 2 120942482 missense possibly damaging 0.86
R4656:Ubr1 UTSW 2 120926013 missense probably benign 0.35
R4765:Ubr1 UTSW 2 120963442 nonsense probably null
R4928:Ubr1 UTSW 2 120914938 missense probably damaging 1.00
R4987:Ubr1 UTSW 2 120963566 missense probably benign 0.00
R5108:Ubr1 UTSW 2 120963422 missense probably benign 0.20
R5118:Ubr1 UTSW 2 120882264 missense probably benign 0.20
R5211:Ubr1 UTSW 2 120893170 missense possibly damaging 0.92
R5215:Ubr1 UTSW 2 120904044 missense probably benign 0.00
R5449:Ubr1 UTSW 2 120963500 missense probably benign
R5452:Ubr1 UTSW 2 120868302 missense possibly damaging 0.95
R5582:Ubr1 UTSW 2 120915407 missense probably benign
R5610:Ubr1 UTSW 2 120892112 missense probably benign 0.04
R5637:Ubr1 UTSW 2 120963517 missense possibly damaging 0.68
R5808:Ubr1 UTSW 2 120961092 missense possibly damaging 0.63
R5845:Ubr1 UTSW 2 120904005 missense probably benign
R5979:Ubr1 UTSW 2 120946382 missense probably benign 0.07
R6044:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R6146:Ubr1 UTSW 2 120893209 missense probably damaging 0.98
R6252:Ubr1 UTSW 2 120906895 missense probably benign 0.21
R6389:Ubr1 UTSW 2 120881039 missense probably benign 0.03
R6600:Ubr1 UTSW 2 120915399 missense probably benign 0.00
R6670:Ubr1 UTSW 2 120924130 critical splice donor site probably null
R6731:Ubr1 UTSW 2 120955640 missense probably null 0.99
R6836:Ubr1 UTSW 2 120896675 splice site probably null
R6994:Ubr1 UTSW 2 120963593 missense probably benign
R7121:Ubr1 UTSW 2 120875498 missense probably benign 0.00
R7204:Ubr1 UTSW 2 120904077 missense possibly damaging 0.49
R7209:Ubr1 UTSW 2 120862765 missense probably benign 0.04
R7434:Ubr1 UTSW 2 120862680 missense probably benign
R7457:Ubr1 UTSW 2 120917828 missense probably benign 0.35
R7464:Ubr1 UTSW 2 120889774 critical splice donor site probably null
R7519:Ubr1 UTSW 2 120875444 missense possibly damaging 0.63
R7574:Ubr1 UTSW 2 120873191 missense possibly damaging 0.93
R8030:Ubr1 UTSW 2 120934374 missense probably damaging 0.99
R8085:Ubr1 UTSW 2 120934417 nonsense probably null
R8221:Ubr1 UTSW 2 120961104 missense probably damaging 0.97
R8241:Ubr1 UTSW 2 120963456 missense possibly damaging 0.80
R8291:Ubr1 UTSW 2 120911115 missense probably benign
R8293:Ubr1 UTSW 2 120862721 missense probably benign 0.38
R8420:Ubr1 UTSW 2 120870995 missense probably benign
R8489:Ubr1 UTSW 2 120881067 missense probably benign 0.42
R8708:Ubr1 UTSW 2 120866483 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCTAGGCACATAAATCATTTAAGGGC -3'
(R):5'- CCTCCTTAATTTGAAATGGGTACTC -3'

Sequencing Primer
(F):5'- TGGACTAAGCCTTTGAACCTCTAAGC -3'
(R):5'- ATAAGCTTTGTCCATGTTGGGTTATC -3'
Posted On2016-06-06