Mutagenetix > Incidental Mutations

Incidental Mutation 'R5033:Ubr1'

389333

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

042624-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.848) question?

Stock #

R5033 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 120911997 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably null
Transcript: ENSMUST00000028728

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129790

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,279,414	V149A	probably benign	Het
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
4931406P16Rik	C	T	7: 34,245,812	G336S	probably benign	Het
9930111J21Rik1	G	A	11: 48,947,706	R685W	probably damaging	Het
Arhgap10	A	T	8: 77,382,757	L399H	probably damaging	Het
Arih2	AGCCG	AG	9: 108,611,660		probably benign	Het
Atp13a2	A	G	4: 141,000,821	H575R	possibly damaging	Het
Bbof1	G	A	12: 84,411,270		probably null	Het
Catsperg2	A	C	7: 29,710,134	Y545D	possibly damaging	Het
Cdc42bpa	T	A	1: 180,065,015	I248N	probably damaging	Het
Cdk11b	A	T	4: 155,648,825		probably benign	Het
Cfap46	C	A	7: 139,603,860	L90F	probably benign	Het
Cndp2	A	G	18: 84,670,829	L276P	possibly damaging	Het
Col3a1	A	C	1: 45,346,110	D129A	probably damaging	Het
Daam1	C	A	12: 71,946,520	H354Q	unknown	Het
Dnah5	T	A	15: 28,421,678	F3892Y	probably damaging	Het
Dnajb3	A	G	1: 88,205,023	V219A	possibly damaging	Het
Drd5	A	G	5: 38,320,201	H179R	probably damaging	Het
Dym	A	G	18: 75,119,161	N333D	possibly damaging	Het
Eif2b3	A	G	4: 117,052,736	D156G	probably damaging	Het
Emc1	A	G	4: 139,371,696	D830G	probably damaging	Het
F13a1	A	C	13: 36,988,856	I183M	probably damaging	Het
Fam136b-ps	T	A	15: 31,276,897		probably benign	Het
Fdft1	C	A	14: 63,163,404	K93N	probably damaging	Het
Gcc2	A	G	10: 58,278,806	D959G	probably damaging	Het
Gm14085	T	A	2: 122,522,914		probably null	Het
Gm853	C	T	4: 130,221,615		probably null	Het
Gp2	A	G	7: 119,454,291	V149A	probably damaging	Het
Gpc1	G	A	1: 92,857,029	G308D	probably damaging	Het
Hdac9	A	T	12: 34,373,907	C587S	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Iars2	A	G	1: 185,317,928	V453A	possibly damaging	Het
Il1r1	T	G	1: 40,293,524	C121W	probably damaging	Het
Jazf1	A	G	6: 52,777,540	Y184H	probably damaging	Het
Kel	A	T	6: 41,699,055	Y234N	probably damaging	Het
Khk	G	A	5: 30,929,660	G186D	probably damaging	Het
Klf4	A	T	4: 55,530,301	M270K	probably benign	Het
Kmt2c	G	A	5: 25,314,708	L2135F	probably benign	Het
Krtap15	A	G	16: 88,829,156	Y37C	probably damaging	Het
Lars	A	G	18: 42,214,776	F994S	possibly damaging	Het
Lrp8	T	C	4: 107,834,755		probably null	Het
Lrrc2	A	T	9: 110,980,919	D341V	probably damaging	Het
Map4k4	A	G	1: 40,007,502	K646R	probably damaging	Het
Mrps9	T	A	1: 42,895,331		probably null	Het
Olfr1130	T	A	2: 87,607,711	C108S	probably damaging	Het
Olfr745	T	A	14: 50,643,162	Y288N	probably damaging	Het
Olfr898	C	T	9: 38,349,628	H176Y	probably damaging	Het
Pcnt	A	T	10: 76,399,945	C1401S	possibly damaging	Het
Pdgfrb	A	T	18: 61,077,668	K749M	probably damaging	Het
Pigo	A	T	4: 43,019,412	W969R	probably null	Het
Pigr	A	T	1: 130,844,699	Y218F	probably damaging	Het
Pih1d1	A	G	7: 45,154,854		probably benign	Het
Pik3cg	A	T	12: 32,199,196		probably null	Het
Pik3r6	A	T	11: 68,533,468	K300*	probably null	Het
Pip5k1c	A	G	10: 81,305,250	D64G	probably damaging	Het
Piwil2	A	T	14: 70,421,593	I161K	possibly damaging	Het
Pou3f1	A	G	4: 124,658,656	E317G	probably damaging	Het
Prdm8	C	T	5: 98,185,212	Q213*	probably null	Het
Prpf6	T	A	2: 181,650,106	C739S	possibly damaging	Het
Psmc3	T	A	2: 91,054,608	S40T	probably benign	Het
Psmd3	A	T	11: 98,682,824	D32V	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rapgef6	A	T	11: 54,691,381	H1373L	possibly damaging	Het
Rnf207	A	C	4: 152,313,209	S328A	probably benign	Het
Ros1	C	T	10: 52,128,416		probably null	Het
Ryr2	T	A	13: 11,587,254	I4581F	possibly damaging	Het
Sacm1l	C	T	9: 123,586,399	R480W	probably damaging	Het
Sec16a	A	G	2: 26,419,649	V664A	probably benign	Het
Selenoo	T	A	15: 89,092,766	M207K	probably damaging	Het
Sh3tc2	G	A	18: 62,014,891		probably null	Het
Slco2b1	G	T	7: 99,660,049	Q692K	probably benign	Het
Slfn4	A	T	11: 83,186,797	D137V	probably damaging	Het
Srrm2	G	A	17: 23,820,618	A2175T	probably damaging	Het
Stard9	T	A	2: 120,693,399	C692S	probably benign	Het
Sulf2	T	A	2: 166,081,622	D559V	probably benign	Het
Tbpl2	T	C	2: 24,087,158	I283V	probably benign	Het
Tmem19	A	G	10: 115,359,761	F46S	probably benign	Het
Trp63	T	A	16: 25,763,306	Y35N	probably damaging	Het
Ttn	T	A	2: 76,886,442		probably benign	Het
Ube2z	A	T	11: 96,050,322	H331Q	probably benign	Het
Uhrf1bp1	A	G	17: 27,886,864	E788G	probably damaging	Het
Vmn1r235	A	T	17: 21,262,288	I292F	possibly damaging	Het
Vmn2r1	T	A	3: 64,105,080	D787E	probably damaging	Het
Vmn2r3	A	G	3: 64,259,799	V637A	probably benign	Het
Xpnpep1	C	A	19: 53,006,175	V341L	probably benign	Het
Yme1l1	A	G	2: 23,194,747	D619G	probably damaging	Het
Zfp597	G	A	16: 3,866,638	P85S	probably damaging	Het
Zscan20	A	G	4: 128,586,128	S857P	probably benign	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120875407	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120941093	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120930872	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120914905	missense	probably benign
IGL01346:Ubr1	APN	2	120873122	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120941131	splice site	probably benign
IGL01539:Ubr1	APN	2	120926013	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120934342	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120875398	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120921386	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120900508	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120946349	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120970603	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120864373	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120870979	splice site	probably benign
IGL02627:Ubr1	APN	2	120940991	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120914883	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120941091	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120881183	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120961156	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120864417	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120895160	missense	probably benign
I1329:Ubr1	UTSW	2	120934294	splice site	probably benign
R0022:Ubr1	UTSW	2	120961173	splice site	probably benign
R0345:Ubr1	UTSW	2	120904103	splice site	probably null
R0373:Ubr1	UTSW	2	120946657	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120906946	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120881093	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120947883	nonsense	probably null
R0723:Ubr1	UTSW	2	120881101	nonsense	probably null
R1178:Ubr1	UTSW	2	120926029	nonsense	probably null
R1401:Ubr1	UTSW	2	120955644	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120961098	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120935319	splice site	probably benign
R1920:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120946273	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120942553	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120864330	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120926047	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120909482	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120963448	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120916470	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120862687	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120946622	splice site	probably null
R4173:Ubr1	UTSW	2	120946622	splice site	probably null
R4174:Ubr1	UTSW	2	120946622	splice site	probably null
R4241:Ubr1	UTSW	2	120934386	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120970603	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120895066	splice site	probably null
R4449:Ubr1	UTSW	2	120946381	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120942482	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120926013	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120963442	nonsense	probably null
R4928:Ubr1	UTSW	2	120914938	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120963566	missense	probably benign	0.00
R5108:Ubr1	UTSW	2	120963422	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120882264	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120893170	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120904044	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120963500	missense	probably benign
R5452:Ubr1	UTSW	2	120868302	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120915407	missense	probably benign
R5610:Ubr1	UTSW	2	120892112	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120963517	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120961092	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120904005	missense	probably benign
R5979:Ubr1	UTSW	2	120946382	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120893209	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120906895	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120881039	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120915399	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120924130	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120955640	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120896675	splice site	probably null
R6994:Ubr1	UTSW	2	120963593	missense	probably benign
R7121:Ubr1	UTSW	2	120875498	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120904077	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120862765	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120862680	missense	probably benign
R7457:Ubr1	UTSW	2	120917828	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120889774	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120875444	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120873191	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120934374	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120934417	nonsense	probably null
R8221:Ubr1	UTSW	2	120961104	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120963456	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120911115	missense	probably benign
R8293:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120870995	missense	probably benign
R8489:Ubr1	UTSW	2	120881067	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120866483	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120904042	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120866553	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120925988	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120924134	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120873122	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120947844	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120896519	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120935284	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120904025	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- GCTAGGCACATAAATCATTTAAGGGC -3'
(R):5'- CCTCCTTAATTTGAAATGGGTACTC -3'

Sequencing Primer
(F):5'- TGGACTAAGCCTTTGAACCTCTAAGC -3'
(R):5'- ATAAGCTTTGTCCATGTTGGGTTATC -3'

Posted On

2016-06-06