Incidental Mutation 'R5033:Pigo'
ID389340
Institutional Source Beutler Lab
Gene Symbol Pigo
Ensembl Gene ENSMUSG00000028454
Gene Namephosphatidylinositol glycan anchor biosynthesis, class O
Synonyms
MMRRC Submission 042624-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5033 (G1)
Quality Score192
Status Not validated
Chromosome4
Chromosomal Location43017635-43025819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43019412 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 969 (W969R)
Ref Sequence ENSEMBL: ENSMUSP00000095713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067481] [ENSMUST00000098109]
Predicted Effect probably null
Transcript: ENSMUST00000067481
AA Change: W937R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454
AA Change: W937R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 173 300 7.3e-17 PFAM
low complexity region 308 321 N/A INTRINSIC
low complexity region 323 336 N/A INTRINSIC
low complexity region 349 360 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
transmembrane domain 448 470 N/A INTRINSIC
transmembrane domain 477 499 N/A INTRINSIC
transmembrane domain 509 528 N/A INTRINSIC
low complexity region 539 559 N/A INTRINSIC
transmembrane domain 669 688 N/A INTRINSIC
transmembrane domain 703 722 N/A INTRINSIC
transmembrane domain 743 765 N/A INTRINSIC
transmembrane domain 829 851 N/A INTRINSIC
transmembrane domain 858 880 N/A INTRINSIC
transmembrane domain 921 940 N/A INTRINSIC
low complexity region 955 979 N/A INTRINSIC
transmembrane domain 992 1014 N/A INTRINSIC
transmembrane domain 1029 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098109
AA Change: W969R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454
AA Change: W969R

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Phosphodiest 129 304 6.5e-18 PFAM
low complexity region 316 329 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 485 507 N/A INTRINSIC
transmembrane domain 517 536 N/A INTRINSIC
low complexity region 547 567 N/A INTRINSIC
transmembrane domain 677 696 N/A INTRINSIC
transmembrane domain 711 730 N/A INTRINSIC
transmembrane domain 751 773 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 866 888 N/A INTRINSIC
transmembrane domain 953 972 N/A INTRINSIC
low complexity region 987 1011 N/A INTRINSIC
transmembrane domain 1024 1046 N/A INTRINSIC
transmembrane domain 1061 1083 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149333
AA Change: W546R
SMART Domains Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454
AA Change: W546R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Phosphodiest 123 299 2.7e-18 PFAM
low complexity region 311 324 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
transmembrane domain 531 550 N/A INTRINSIC
low complexity region 565 589 N/A INTRINSIC
transmembrane domain 602 624 N/A INTRINSIC
transmembrane domain 639 661 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155429
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This protein is involved in the transfer of ethanolaminephosphate (EtNP) to the third mannose in GPI. At least three alternatively spliced transcripts encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,279,414 V149A probably benign Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4931406P16Rik C T 7: 34,245,812 G336S probably benign Het
9930111J21Rik1 G A 11: 48,947,706 R685W probably damaging Het
Arhgap10 A T 8: 77,382,757 L399H probably damaging Het
Arih2 AGCCG AG 9: 108,611,660 probably benign Het
Atp13a2 A G 4: 141,000,821 H575R possibly damaging Het
Bbof1 G A 12: 84,411,270 probably null Het
Catsperg2 A C 7: 29,710,134 Y545D possibly damaging Het
Cdc42bpa T A 1: 180,065,015 I248N probably damaging Het
Cdk11b A T 4: 155,648,825 probably benign Het
Cfap46 C A 7: 139,603,860 L90F probably benign Het
Cndp2 A G 18: 84,670,829 L276P possibly damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Daam1 C A 12: 71,946,520 H354Q unknown Het
Dnah5 T A 15: 28,421,678 F3892Y probably damaging Het
Dnajb3 A G 1: 88,205,023 V219A possibly damaging Het
Drd5 A G 5: 38,320,201 H179R probably damaging Het
Dym A G 18: 75,119,161 N333D possibly damaging Het
Eif2b3 A G 4: 117,052,736 D156G probably damaging Het
Emc1 A G 4: 139,371,696 D830G probably damaging Het
F13a1 A C 13: 36,988,856 I183M probably damaging Het
Fam136b-ps T A 15: 31,276,897 probably benign Het
Fdft1 C A 14: 63,163,404 K93N probably damaging Het
Gcc2 A G 10: 58,278,806 D959G probably damaging Het
Gm14085 T A 2: 122,522,914 probably null Het
Gm853 C T 4: 130,221,615 probably null Het
Gp2 A G 7: 119,454,291 V149A probably damaging Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Hdac9 A T 12: 34,373,907 C587S probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Iars2 A G 1: 185,317,928 V453A possibly damaging Het
Il1r1 T G 1: 40,293,524 C121W probably damaging Het
Jazf1 A G 6: 52,777,540 Y184H probably damaging Het
Kel A T 6: 41,699,055 Y234N probably damaging Het
Khk G A 5: 30,929,660 G186D probably damaging Het
Klf4 A T 4: 55,530,301 M270K probably benign Het
Kmt2c G A 5: 25,314,708 L2135F probably benign Het
Krtap15 A G 16: 88,829,156 Y37C probably damaging Het
Lars A G 18: 42,214,776 F994S possibly damaging Het
Lrp8 T C 4: 107,834,755 probably null Het
Lrrc2 A T 9: 110,980,919 D341V probably damaging Het
Map4k4 A G 1: 40,007,502 K646R probably damaging Het
Mrps9 T A 1: 42,895,331 probably null Het
Olfr1130 T A 2: 87,607,711 C108S probably damaging Het
Olfr745 T A 14: 50,643,162 Y288N probably damaging Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pcnt A T 10: 76,399,945 C1401S possibly damaging Het
Pdgfrb A T 18: 61,077,668 K749M probably damaging Het
Pigr A T 1: 130,844,699 Y218F probably damaging Het
Pih1d1 A G 7: 45,154,854 probably benign Het
Pik3cg A T 12: 32,199,196 probably null Het
Pik3r6 A T 11: 68,533,468 K300* probably null Het
Pip5k1c A G 10: 81,305,250 D64G probably damaging Het
Piwil2 A T 14: 70,421,593 I161K possibly damaging Het
Pou3f1 A G 4: 124,658,656 E317G probably damaging Het
Prdm8 C T 5: 98,185,212 Q213* probably null Het
Prpf6 T A 2: 181,650,106 C739S possibly damaging Het
Psmc3 T A 2: 91,054,608 S40T probably benign Het
Psmd3 A T 11: 98,682,824 D32V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rapgef6 A T 11: 54,691,381 H1373L possibly damaging Het
Rnf207 A C 4: 152,313,209 S328A probably benign Het
Ros1 C T 10: 52,128,416 probably null Het
Ryr2 T A 13: 11,587,254 I4581F possibly damaging Het
Sacm1l C T 9: 123,586,399 R480W probably damaging Het
Sec16a A G 2: 26,419,649 V664A probably benign Het
Selenoo T A 15: 89,092,766 M207K probably damaging Het
Sh3tc2 G A 18: 62,014,891 probably null Het
Slco2b1 G T 7: 99,660,049 Q692K probably benign Het
Slfn4 A T 11: 83,186,797 D137V probably damaging Het
Srrm2 G A 17: 23,820,618 A2175T probably damaging Het
Stard9 T A 2: 120,693,399 C692S probably benign Het
Sulf2 T A 2: 166,081,622 D559V probably benign Het
Tbpl2 T C 2: 24,087,158 I283V probably benign Het
Tmem19 A G 10: 115,359,761 F46S probably benign Het
Trp63 T A 16: 25,763,306 Y35N probably damaging Het
Ttn T A 2: 76,886,442 probably benign Het
Ube2z A T 11: 96,050,322 H331Q probably benign Het
Ubr1 C T 2: 120,911,997 probably null Het
Uhrf1bp1 A G 17: 27,886,864 E788G probably damaging Het
Vmn1r235 A T 17: 21,262,288 I292F possibly damaging Het
Vmn2r1 T A 3: 64,105,080 D787E probably damaging Het
Vmn2r3 A G 3: 64,259,799 V637A probably benign Het
Xpnpep1 C A 19: 53,006,175 V341L probably benign Het
Yme1l1 A G 2: 23,194,747 D619G probably damaging Het
Zfp597 G A 16: 3,866,638 P85S probably damaging Het
Zscan20 A G 4: 128,586,128 S857P probably benign Het
Other mutations in Pigo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Pigo APN 4 43021767 missense possibly damaging 0.63
IGL02176:Pigo APN 4 43019352 missense probably benign 0.20
IGL03197:Pigo APN 4 43022103 missense possibly damaging 0.92
R0207:Pigo UTSW 4 43023824 splice site probably benign
R0464:Pigo UTSW 4 43019814 missense probably benign 0.02
R0891:Pigo UTSW 4 43020519 nonsense probably null
R1445:Pigo UTSW 4 43021460 missense probably benign
R1484:Pigo UTSW 4 43024779 missense probably damaging 0.99
R1547:Pigo UTSW 4 43020689 missense probably benign 0.01
R1624:Pigo UTSW 4 43024661 missense probably damaging 1.00
R1847:Pigo UTSW 4 43024710 nonsense probably null
R3110:Pigo UTSW 4 43021083 missense probably benign 0.00
R3111:Pigo UTSW 4 43021083 missense probably benign 0.00
R3112:Pigo UTSW 4 43021083 missense probably benign 0.00
R3824:Pigo UTSW 4 43020909 missense possibly damaging 0.95
R3850:Pigo UTSW 4 43025084 missense probably benign 0.01
R3980:Pigo UTSW 4 43019231 missense probably damaging 1.00
R3982:Pigo UTSW 4 43023482 missense probably benign 0.00
R4520:Pigo UTSW 4 43020301 missense probably benign 0.16
R5054:Pigo UTSW 4 43021337 missense probably damaging 1.00
R5240:Pigo UTSW 4 43020675 missense possibly damaging 0.95
R5390:Pigo UTSW 4 43019645 critical splice donor site probably null
R5468:Pigo UTSW 4 43024562 critical splice donor site probably null
R5775:Pigo UTSW 4 43023475 missense probably damaging 1.00
R5839:Pigo UTSW 4 43022104 missense probably damaging 1.00
R5924:Pigo UTSW 4 43023389 nonsense probably null
R6111:Pigo UTSW 4 43019724 missense probably benign 0.18
R6451:Pigo UTSW 4 43021412 missense probably benign
R6533:Pigo UTSW 4 43022697 missense probably benign 0.07
R6884:Pigo UTSW 4 43022627 missense possibly damaging 0.88
R7026:Pigo UTSW 4 43023380 nonsense probably null
R7591:Pigo UTSW 4 43025093 missense probably benign
R7876:Pigo UTSW 4 43020671 missense probably benign 0.00
R7959:Pigo UTSW 4 43020671 missense probably benign 0.00
Z1088:Pigo UTSW 4 43019409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGAGCTCCAAGGATAAAG -3'
(R):5'- CTCCTGCTTTGTGGGAAGAAAAG -3'

Sequencing Primer
(F):5'- AGAGGTACTTGAGGCCCAGC -3'
(R):5'- CTTTGTGGGAAGAAAAGAGAGTGTTG -3'
Posted On2016-06-06