Mutagenetix > Incidental Mutations

Incidental Mutation 'R5033:Pigo'

389340

Institutional Source

Beutler Lab

Gene Symbol

Pigo

Ensembl Gene

ENSMUSG00000028454

Gene Name

phosphatidylinositol glycan anchor biosynthesis, class O

Synonyms

MMRRC Submission

042624-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5033 (G1)

Quality Score

192

Status

Not validated

Chromosome

Chromosomal Location

43017635-43025819 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 43019412 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 969 (W969R)

Ref Sequence

ENSEMBL: ENSMUSP00000095713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067481] [ENSMUST00000098109]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000067481
AA Change: W937R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069749
Gene: ENSMUSG00000028454
AA Change: W937R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Phosphodiest	173	300	7.3e-17	PFAM
low complexity region	308	321	N/A	INTRINSIC
low complexity region	323	336	N/A	INTRINSIC
low complexity region	349	360	N/A	INTRINSIC
low complexity region	417	428	N/A	INTRINSIC
transmembrane domain	448	470	N/A	INTRINSIC
transmembrane domain	477	499	N/A	INTRINSIC
transmembrane domain	509	528	N/A	INTRINSIC
low complexity region	539	559	N/A	INTRINSIC
transmembrane domain	669	688	N/A	INTRINSIC
transmembrane domain	703	722	N/A	INTRINSIC
transmembrane domain	743	765	N/A	INTRINSIC
transmembrane domain	829	851	N/A	INTRINSIC
transmembrane domain	858	880	N/A	INTRINSIC
transmembrane domain	921	940	N/A	INTRINSIC
low complexity region	955	979	N/A	INTRINSIC
transmembrane domain	992	1014	N/A	INTRINSIC
transmembrane domain	1029	1051	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000098109
AA Change: W969R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095713
Gene: ENSMUSG00000028454
AA Change: W969R

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
Pfam:Phosphodiest	129	304	6.5e-18	PFAM
low complexity region	316	329	N/A	INTRINSIC
low complexity region	331	344	N/A	INTRINSIC
low complexity region	357	368	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
transmembrane domain	456	478	N/A	INTRINSIC
transmembrane domain	485	507	N/A	INTRINSIC
transmembrane domain	517	536	N/A	INTRINSIC
low complexity region	547	567	N/A	INTRINSIC
transmembrane domain	677	696	N/A	INTRINSIC
transmembrane domain	711	730	N/A	INTRINSIC
transmembrane domain	751	773	N/A	INTRINSIC
transmembrane domain	837	859	N/A	INTRINSIC
transmembrane domain	866	888	N/A	INTRINSIC
transmembrane domain	953	972	N/A	INTRINSIC
low complexity region	987	1011	N/A	INTRINSIC
transmembrane domain	1024	1046	N/A	INTRINSIC
transmembrane domain	1061	1083	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000149333
AA Change: W546R

SMART Domains

Protein: ENSMUSP00000114917
Gene: ENSMUSG00000028454
AA Change: W546R

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:Phosphodiest	123	299	2.7e-18	PFAM
low complexity region	311	324	N/A	INTRINSIC
low complexity region	326	339	N/A	INTRINSIC
low complexity region	352	363	N/A	INTRINSIC
low complexity region	420	431	N/A	INTRINSIC
low complexity region	450	460	N/A	INTRINSIC
transmembrane domain	531	550	N/A	INTRINSIC
low complexity region	565	589	N/A	INTRINSIC
transmembrane domain	602	624	N/A	INTRINSIC
transmembrane domain	639	661	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155429

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid which contains three mannose molecules in its core backbone. The GPI-anchor is found on many blood cells and serves to anchor proteins to the cell surface. This protein is involved in the transfer of ethanolaminephosphate (EtNP) to the third mannose in GPI. At least three alternatively spliced transcripts encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,279,414	V149A	probably benign	Het
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
4931406P16Rik	C	T	7: 34,245,812	G336S	probably benign	Het
9930111J21Rik1	G	A	11: 48,947,706	R685W	probably damaging	Het
Arhgap10	A	T	8: 77,382,757	L399H	probably damaging	Het
Arih2	AGCCG	AG	9: 108,611,660		probably benign	Het
Atp13a2	A	G	4: 141,000,821	H575R	possibly damaging	Het
Bbof1	G	A	12: 84,411,270		probably null	Het
Catsperg2	A	C	7: 29,710,134	Y545D	possibly damaging	Het
Cdc42bpa	T	A	1: 180,065,015	I248N	probably damaging	Het
Cdk11b	A	T	4: 155,648,825		probably benign	Het
Cfap46	C	A	7: 139,603,860	L90F	probably benign	Het
Cndp2	A	G	18: 84,670,829	L276P	possibly damaging	Het
Col3a1	A	C	1: 45,346,110	D129A	probably damaging	Het
Daam1	C	A	12: 71,946,520	H354Q	unknown	Het
Dnah5	T	A	15: 28,421,678	F3892Y	probably damaging	Het
Dnajb3	A	G	1: 88,205,023	V219A	possibly damaging	Het
Drd5	A	G	5: 38,320,201	H179R	probably damaging	Het
Dym	A	G	18: 75,119,161	N333D	possibly damaging	Het
Eif2b3	A	G	4: 117,052,736	D156G	probably damaging	Het
Emc1	A	G	4: 139,371,696	D830G	probably damaging	Het
F13a1	A	C	13: 36,988,856	I183M	probably damaging	Het
Fam136b-ps	T	A	15: 31,276,897		probably benign	Het
Fdft1	C	A	14: 63,163,404	K93N	probably damaging	Het
Gcc2	A	G	10: 58,278,806	D959G	probably damaging	Het
Gm14085	T	A	2: 122,522,914		probably null	Het
Gm853	C	T	4: 130,221,615		probably null	Het
Gp2	A	G	7: 119,454,291	V149A	probably damaging	Het
Gpc1	G	A	1: 92,857,029	G308D	probably damaging	Het
Hdac9	A	T	12: 34,373,907	C587S	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Iars2	A	G	1: 185,317,928	V453A	possibly damaging	Het
Il1r1	T	G	1: 40,293,524	C121W	probably damaging	Het
Jazf1	A	G	6: 52,777,540	Y184H	probably damaging	Het
Kel	A	T	6: 41,699,055	Y234N	probably damaging	Het
Khk	G	A	5: 30,929,660	G186D	probably damaging	Het
Klf4	A	T	4: 55,530,301	M270K	probably benign	Het
Kmt2c	G	A	5: 25,314,708	L2135F	probably benign	Het
Krtap15	A	G	16: 88,829,156	Y37C	probably damaging	Het
Lars	A	G	18: 42,214,776	F994S	possibly damaging	Het
Lrp8	T	C	4: 107,834,755		probably null	Het
Lrrc2	A	T	9: 110,980,919	D341V	probably damaging	Het
Map4k4	A	G	1: 40,007,502	K646R	probably damaging	Het
Mrps9	T	A	1: 42,895,331		probably null	Het
Olfr1130	T	A	2: 87,607,711	C108S	probably damaging	Het
Olfr745	T	A	14: 50,643,162	Y288N	probably damaging	Het
Olfr898	C	T	9: 38,349,628	H176Y	probably damaging	Het
Pcnt	A	T	10: 76,399,945	C1401S	possibly damaging	Het
Pdgfrb	A	T	18: 61,077,668	K749M	probably damaging	Het
Pigr	A	T	1: 130,844,699	Y218F	probably damaging	Het
Pih1d1	A	G	7: 45,154,854		probably benign	Het
Pik3cg	A	T	12: 32,199,196		probably null	Het
Pik3r6	A	T	11: 68,533,468	K300*	probably null	Het
Pip5k1c	A	G	10: 81,305,250	D64G	probably damaging	Het
Piwil2	A	T	14: 70,421,593	I161K	possibly damaging	Het
Pou3f1	A	G	4: 124,658,656	E317G	probably damaging	Het
Prdm8	C	T	5: 98,185,212	Q213*	probably null	Het
Prpf6	T	A	2: 181,650,106	C739S	possibly damaging	Het
Psmc3	T	A	2: 91,054,608	S40T	probably benign	Het
Psmd3	A	T	11: 98,682,824	D32V	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rapgef6	A	T	11: 54,691,381	H1373L	possibly damaging	Het
Rnf207	A	C	4: 152,313,209	S328A	probably benign	Het
Ros1	C	T	10: 52,128,416		probably null	Het
Ryr2	T	A	13: 11,587,254	I4581F	possibly damaging	Het
Sacm1l	C	T	9: 123,586,399	R480W	probably damaging	Het
Sec16a	A	G	2: 26,419,649	V664A	probably benign	Het
Selenoo	T	A	15: 89,092,766	M207K	probably damaging	Het
Sh3tc2	G	A	18: 62,014,891		probably null	Het
Slco2b1	G	T	7: 99,660,049	Q692K	probably benign	Het
Slfn4	A	T	11: 83,186,797	D137V	probably damaging	Het
Srrm2	G	A	17: 23,820,618	A2175T	probably damaging	Het
Stard9	T	A	2: 120,693,399	C692S	probably benign	Het
Sulf2	T	A	2: 166,081,622	D559V	probably benign	Het
Tbpl2	T	C	2: 24,087,158	I283V	probably benign	Het
Tmem19	A	G	10: 115,359,761	F46S	probably benign	Het
Trp63	T	A	16: 25,763,306	Y35N	probably damaging	Het
Ttn	T	A	2: 76,886,442		probably benign	Het
Ube2z	A	T	11: 96,050,322	H331Q	probably benign	Het
Ubr1	C	T	2: 120,911,997		probably null	Het
Uhrf1bp1	A	G	17: 27,886,864	E788G	probably damaging	Het
Vmn1r235	A	T	17: 21,262,288	I292F	possibly damaging	Het
Vmn2r1	T	A	3: 64,105,080	D787E	probably damaging	Het
Vmn2r3	A	G	3: 64,259,799	V637A	probably benign	Het
Xpnpep1	C	A	19: 53,006,175	V341L	probably benign	Het
Yme1l1	A	G	2: 23,194,747	D619G	probably damaging	Het
Zfp597	G	A	16: 3,866,638	P85S	probably damaging	Het
Zscan20	A	G	4: 128,586,128	S857P	probably benign	Het

Other mutations in Pigo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Pigo	APN	4	43021767	missense	possibly damaging	0.63
IGL02176:Pigo	APN	4	43019352	missense	probably benign	0.20
IGL03197:Pigo	APN	4	43022103	missense	possibly damaging	0.92
R0207:Pigo	UTSW	4	43023824	splice site	probably benign
R0464:Pigo	UTSW	4	43019814	missense	probably benign	0.02
R0891:Pigo	UTSW	4	43020519	nonsense	probably null
R1445:Pigo	UTSW	4	43021460	missense	probably benign
R1484:Pigo	UTSW	4	43024779	missense	probably damaging	0.99
R1547:Pigo	UTSW	4	43020689	missense	probably benign	0.01
R1624:Pigo	UTSW	4	43024661	missense	probably damaging	1.00
R1847:Pigo	UTSW	4	43024710	nonsense	probably null
R3110:Pigo	UTSW	4	43021083	missense	probably benign	0.00
R3111:Pigo	UTSW	4	43021083	missense	probably benign	0.00
R3112:Pigo	UTSW	4	43021083	missense	probably benign	0.00
R3824:Pigo	UTSW	4	43020909	missense	possibly damaging	0.95
R3850:Pigo	UTSW	4	43025084	missense	probably benign	0.01
R3980:Pigo	UTSW	4	43019231	missense	probably damaging	1.00
R3982:Pigo	UTSW	4	43023482	missense	probably benign	0.00
R4520:Pigo	UTSW	4	43020301	missense	probably benign	0.16
R5054:Pigo	UTSW	4	43021337	missense	probably damaging	1.00
R5240:Pigo	UTSW	4	43020675	missense	possibly damaging	0.95
R5390:Pigo	UTSW	4	43019645	critical splice donor site	probably null
R5468:Pigo	UTSW	4	43024562	critical splice donor site	probably null
R5775:Pigo	UTSW	4	43023475	missense	probably damaging	1.00
R5839:Pigo	UTSW	4	43022104	missense	probably damaging	1.00
R5924:Pigo	UTSW	4	43023389	nonsense	probably null
R6111:Pigo	UTSW	4	43019724	missense	probably benign	0.18
R6451:Pigo	UTSW	4	43021412	missense	probably benign
R6533:Pigo	UTSW	4	43022697	missense	probably benign	0.07
R6884:Pigo	UTSW	4	43022627	missense	possibly damaging	0.88
R7026:Pigo	UTSW	4	43023380	nonsense	probably null
R7591:Pigo	UTSW	4	43025093	missense	probably benign
R7876:Pigo	UTSW	4	43020671	missense	probably benign	0.00
R8754:Pigo	UTSW	4	43024724	missense	probably benign	0.39
R8794:Pigo	UTSW	4	43023787	missense	possibly damaging	0.48
Z1088:Pigo	UTSW	4	43019409	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCTGAGCTCCAAGGATAAAG -3'
(R):5'- CTCCTGCTTTGTGGGAAGAAAAG -3'

Sequencing Primer
(F):5'- AGAGGTACTTGAGGCCCAGC -3'
(R):5'- CTTTGTGGGAAGAAAAGAGAGTGTTG -3'

Posted On

2016-06-06