Incidental Mutation 'R5033:Emc1'
ID 389348
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission 042624-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.966) question?
Stock # R5033 (G1)
Quality Score 215
Status Not validated
Chromosome 4
Chromosomal Location 139079898-139106041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139099007 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 830 (D830G)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect probably benign
Transcript: ENSMUST00000042096
AA Change: D827G

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: D827G

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082262
AA Change: D830G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: D830G

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably damaging
Transcript: ENSMUST00000179784
AA Change: D830G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: D830G

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181556
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
9930111J21Rik1 G A 11: 48,838,533 (GRCm39) R685W probably damaging Het
Arhgap10 A T 8: 78,109,386 (GRCm39) L399H probably damaging Het
Arih2 AGCCG AG 9: 108,488,859 (GRCm39) probably benign Het
Atp13a2 A G 4: 140,728,132 (GRCm39) H575R possibly damaging Het
Bbof1 G A 12: 84,458,044 (GRCm39) probably null Het
Bltp3a A G 17: 28,105,838 (GRCm39) E788G probably damaging Het
Catsperg2 A C 7: 29,409,559 (GRCm39) Y545D possibly damaging Het
Cdc42bpa T A 1: 179,892,580 (GRCm39) I248N probably damaging Het
Cdk11b A T 4: 155,733,282 (GRCm39) probably benign Het
Cfap46 C A 7: 139,183,776 (GRCm39) L90F probably benign Het
Cndp2 A G 18: 84,688,954 (GRCm39) L276P possibly damaging Het
Col3a1 A C 1: 45,385,270 (GRCm39) D129A probably damaging Het
Daam1 C A 12: 71,993,294 (GRCm39) H354Q unknown Het
Dnah5 T A 15: 28,421,824 (GRCm39) F3892Y probably damaging Het
Dnajb3 A G 1: 88,132,745 (GRCm39) V219A possibly damaging Het
Drd5 A G 5: 38,477,544 (GRCm39) H179R probably damaging Het
Dym A G 18: 75,252,232 (GRCm39) N333D possibly damaging Het
Eif2b3 A G 4: 116,909,933 (GRCm39) D156G probably damaging Het
F13a1 A C 13: 37,172,830 (GRCm39) I183M probably damaging Het
Fam136b-ps T A 15: 31,277,043 (GRCm39) probably benign Het
Fdft1 C A 14: 63,400,853 (GRCm39) K93N probably damaging Het
Garre1 C T 7: 33,945,237 (GRCm39) G336S probably benign Het
Gcc2 A G 10: 58,114,628 (GRCm39) D959G probably damaging Het
Gp2 A G 7: 119,053,514 (GRCm39) V149A probably damaging Het
Gpc1 G A 1: 92,784,751 (GRCm39) G308D probably damaging Het
Hdac9 A T 12: 34,423,906 (GRCm39) C587S probably benign Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Iars2 A G 1: 185,050,125 (GRCm39) V453A possibly damaging Het
Il1r1 T G 1: 40,332,684 (GRCm39) C121W probably damaging Het
Inhca A G 9: 103,156,613 (GRCm39) V149A probably benign Het
Jazf1 A G 6: 52,754,525 (GRCm39) Y184H probably damaging Het
Kel A T 6: 41,675,989 (GRCm39) Y234N probably damaging Het
Khk G A 5: 31,087,004 (GRCm39) G186D probably damaging Het
Klf4 A T 4: 55,530,301 (GRCm39) M270K probably benign Het
Kmt2c G A 5: 25,519,706 (GRCm39) L2135F probably benign Het
Krtap15-1 A G 16: 88,626,044 (GRCm39) Y37C probably damaging Het
Lars1 A G 18: 42,347,841 (GRCm39) F994S possibly damaging Het
Ldc1 C T 4: 130,115,408 (GRCm39) probably null Het
Lrp8 T C 4: 107,691,952 (GRCm39) probably null Het
Lrrc2 A T 9: 110,809,987 (GRCm39) D341V probably damaging Het
Map4k4 A G 1: 40,046,662 (GRCm39) K646R probably damaging Het
Mrps9 T A 1: 42,934,491 (GRCm39) probably null Het
Or10ag60 T A 2: 87,438,055 (GRCm39) C108S probably damaging Het
Or11h6 T A 14: 50,880,619 (GRCm39) Y288N probably damaging Het
Or8c20 C T 9: 38,260,924 (GRCm39) H176Y probably damaging Het
Pcnt A T 10: 76,235,779 (GRCm39) C1401S possibly damaging Het
Pdgfrb A T 18: 61,210,740 (GRCm39) K749M probably damaging Het
Pigo A T 4: 43,019,412 (GRCm39) W969R probably null Het
Pigr A T 1: 130,772,436 (GRCm39) Y218F probably damaging Het
Pih1d1 A G 7: 44,804,278 (GRCm39) probably benign Het
Pik3cg A T 12: 32,249,195 (GRCm39) probably null Het
Pik3r6 A T 11: 68,424,294 (GRCm39) K300* probably null Het
Pip5k1c A G 10: 81,141,084 (GRCm39) D64G probably damaging Het
Piwil2 A T 14: 70,659,042 (GRCm39) I161K possibly damaging Het
Pou3f1 A G 4: 124,552,449 (GRCm39) E317G probably damaging Het
Prdm8 C T 5: 98,333,071 (GRCm39) Q213* probably null Het
Prpf6 T A 2: 181,291,899 (GRCm39) C739S possibly damaging Het
Psmc3 T A 2: 90,884,953 (GRCm39) S40T probably benign Het
Psmd3 A T 11: 98,573,650 (GRCm39) D32V probably damaging Het
Ptpro T A 6: 137,420,592 (GRCm39) V1007D probably damaging Het
Rapgef6 A T 11: 54,582,207 (GRCm39) H1373L possibly damaging Het
Rnf207 A C 4: 152,397,666 (GRCm39) S328A probably benign Het
Ros1 C T 10: 52,004,512 (GRCm39) probably null Het
Ryr2 T A 13: 11,602,140 (GRCm39) I4581F possibly damaging Het
Sacm1l C T 9: 123,415,464 (GRCm39) R480W probably damaging Het
Sec16a A G 2: 26,309,661 (GRCm39) V664A probably benign Het
Selenoo T A 15: 88,976,969 (GRCm39) M207K probably damaging Het
Sh3tc2 G A 18: 62,147,962 (GRCm39) probably null Het
Slc28a2b T A 2: 122,353,395 (GRCm39) probably null Het
Slco2b1 G T 7: 99,309,256 (GRCm39) Q692K probably benign Het
Slfn4 A T 11: 83,077,623 (GRCm39) D137V probably damaging Het
Srrm2 G A 17: 24,039,592 (GRCm39) A2175T probably damaging Het
Stard9 T A 2: 120,523,880 (GRCm39) C692S probably benign Het
Sulf2 T A 2: 165,923,542 (GRCm39) D559V probably benign Het
Tbpl2 T C 2: 23,977,170 (GRCm39) I283V probably benign Het
Tmem19 A G 10: 115,195,666 (GRCm39) F46S probably benign Het
Trp63 T A 16: 25,582,056 (GRCm39) Y35N probably damaging Het
Ttn T A 2: 76,716,786 (GRCm39) probably benign Het
Ube2z A T 11: 95,941,148 (GRCm39) H331Q probably benign Het
Ubr1 C T 2: 120,742,478 (GRCm39) probably null Het
Vmn1r235 A T 17: 21,482,550 (GRCm39) I292F possibly damaging Het
Vmn2r1 T A 3: 64,012,501 (GRCm39) D787E probably damaging Het
Vmn2r3 A G 3: 64,167,220 (GRCm39) V637A probably benign Het
Xpnpep1 C A 19: 52,994,606 (GRCm39) V341L probably benign Het
Yme1l1 A G 2: 23,084,759 (GRCm39) D619G probably damaging Het
Zfp597 G A 16: 3,684,502 (GRCm39) P85S probably damaging Het
Zscan20 A G 4: 128,479,921 (GRCm39) S857P probably benign Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139,082,393 (GRCm39) splice site probably benign
IGL00898:Emc1 APN 4 139,098,941 (GRCm39) missense probably damaging 1.00
IGL01481:Emc1 APN 4 139,089,410 (GRCm39) missense probably benign 0.00
IGL02174:Emc1 APN 4 139,098,979 (GRCm39) missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139,102,775 (GRCm39) missense probably damaging 1.00
IGL02501:Emc1 APN 4 139,098,295 (GRCm39) missense probably benign 0.00
IGL02697:Emc1 APN 4 139,079,955 (GRCm39) missense probably benign
IGL03355:Emc1 APN 4 139,098,904 (GRCm39) splice site probably benign
IGL03386:Emc1 APN 4 139,091,092 (GRCm39) critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139,086,588 (GRCm39) missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0051:Emc1 UTSW 4 139,102,474 (GRCm39) missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.99
R0613:Emc1 UTSW 4 139,102,383 (GRCm39) splice site probably benign
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1512:Emc1 UTSW 4 139,087,495 (GRCm39) splice site probably null
R1702:Emc1 UTSW 4 139,102,512 (GRCm39) missense probably damaging 1.00
R1839:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.98
R1843:Emc1 UTSW 4 139,102,823 (GRCm39) missense probably benign 0.02
R1850:Emc1 UTSW 4 139,086,684 (GRCm39) splice site probably benign
R2024:Emc1 UTSW 4 139,088,257 (GRCm39) missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139,093,841 (GRCm39) missense probably benign 0.08
R2912:Emc1 UTSW 4 139,092,571 (GRCm39) missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139,090,496 (GRCm39) nonsense probably null
R4738:Emc1 UTSW 4 139,089,513 (GRCm39) missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139,102,476 (GRCm39) nonsense probably null
R5322:Emc1 UTSW 4 139,081,557 (GRCm39) missense probably damaging 1.00
R5375:Emc1 UTSW 4 139,093,802 (GRCm39) missense probably damaging 0.96
R5483:Emc1 UTSW 4 139,102,687 (GRCm39) missense probably damaging 1.00
R5587:Emc1 UTSW 4 139,089,459 (GRCm39) missense probably damaging 0.98
R5687:Emc1 UTSW 4 139,102,691 (GRCm39) missense probably damaging 1.00
R5938:Emc1 UTSW 4 139,084,931 (GRCm39) missense probably benign
R6056:Emc1 UTSW 4 139,081,533 (GRCm39) missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139,093,689 (GRCm39) missense probably benign 0.01
R6174:Emc1 UTSW 4 139,093,842 (GRCm39) missense probably benign 0.01
R6208:Emc1 UTSW 4 139,081,582 (GRCm39) missense probably damaging 0.99
R6340:Emc1 UTSW 4 139,092,874 (GRCm39) missense probably damaging 1.00
R6371:Emc1 UTSW 4 139,098,976 (GRCm39) nonsense probably null
R6889:Emc1 UTSW 4 139,092,661 (GRCm39) missense probably damaging 0.97
R7592:Emc1 UTSW 4 139,087,877 (GRCm39) missense probably benign 0.00
R7699:Emc1 UTSW 4 139,082,181 (GRCm39) missense probably benign
R7715:Emc1 UTSW 4 139,098,934 (GRCm39) missense probably damaging 1.00
R7984:Emc1 UTSW 4 139,102,760 (GRCm39) missense probably damaging 1.00
R8112:Emc1 UTSW 4 139,094,498 (GRCm39) missense probably benign 0.00
R8325:Emc1 UTSW 4 139,092,521 (GRCm39) missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139,088,600 (GRCm39) missense probably benign
R8751:Emc1 UTSW 4 139,097,279 (GRCm39) missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139,093,705 (GRCm39) missense probably damaging 0.98
R9482:Emc1 UTSW 4 139,088,201 (GRCm39) missense probably damaging 0.96
R9610:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
R9611:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGCAGCTGGGTCTTTTCCTC -3'
(R):5'- AAGTGGCTCATGAAATCCAGC -3'

Sequencing Primer
(F):5'- TCCCTGGTCTGCAGCTG -3'
(R):5'- GTGGCTCATGAAATCCAGCACTAAG -3'
Posted On 2016-06-06