Incidental Mutation 'R5033:Catsperg2'
ID389364
Institutional Source Beutler Lab
Gene Symbol Catsperg2
Ensembl Gene ENSMUSG00000049123
Gene Namecation channel sperm associated auxiliary subunit gamma 2
Synonyms1700067C01Rik, CATSPERG
MMRRC Submission 042624-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5033 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29697219-29727032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 29710134 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 545 (Y545D)
Ref Sequence ENSEMBL: ENSMUSP00000147099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061193] [ENSMUST00000207115] [ENSMUST00000208371] [ENSMUST00000208607] [ENSMUST00000209126]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061193
AA Change: Y545D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052285
Gene: ENSMUSG00000049123
AA Change: Y545D

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208345
Predicted Effect probably benign
Transcript: ENSMUST00000208371
Predicted Effect possibly damaging
Transcript: ENSMUST00000208607
AA Change: Y545D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209126
AA Change: Y545D

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,279,414 V149A probably benign Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4931406P16Rik C T 7: 34,245,812 G336S probably benign Het
9930111J21Rik1 G A 11: 48,947,706 R685W probably damaging Het
Arhgap10 A T 8: 77,382,757 L399H probably damaging Het
Arih2 AGCCG AG 9: 108,611,660 probably benign Het
Atp13a2 A G 4: 141,000,821 H575R possibly damaging Het
Bbof1 G A 12: 84,411,270 probably null Het
Cdc42bpa T A 1: 180,065,015 I248N probably damaging Het
Cdk11b A T 4: 155,648,825 probably benign Het
Cfap46 C A 7: 139,603,860 L90F probably benign Het
Cndp2 A G 18: 84,670,829 L276P possibly damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Daam1 C A 12: 71,946,520 H354Q unknown Het
Dnah5 T A 15: 28,421,678 F3892Y probably damaging Het
Dnajb3 A G 1: 88,205,023 V219A possibly damaging Het
Drd5 A G 5: 38,320,201 H179R probably damaging Het
Dym A G 18: 75,119,161 N333D possibly damaging Het
Eif2b3 A G 4: 117,052,736 D156G probably damaging Het
Emc1 A G 4: 139,371,696 D830G probably damaging Het
F13a1 A C 13: 36,988,856 I183M probably damaging Het
Fam136b-ps T A 15: 31,276,897 probably benign Het
Fdft1 C A 14: 63,163,404 K93N probably damaging Het
Gcc2 A G 10: 58,278,806 D959G probably damaging Het
Gm14085 T A 2: 122,522,914 probably null Het
Gm853 C T 4: 130,221,615 probably null Het
Gp2 A G 7: 119,454,291 V149A probably damaging Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Hdac9 A T 12: 34,373,907 C587S probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Iars2 A G 1: 185,317,928 V453A possibly damaging Het
Il1r1 T G 1: 40,293,524 C121W probably damaging Het
Jazf1 A G 6: 52,777,540 Y184H probably damaging Het
Kel A T 6: 41,699,055 Y234N probably damaging Het
Khk G A 5: 30,929,660 G186D probably damaging Het
Klf4 A T 4: 55,530,301 M270K probably benign Het
Kmt2c G A 5: 25,314,708 L2135F probably benign Het
Krtap15 A G 16: 88,829,156 Y37C probably damaging Het
Lars A G 18: 42,214,776 F994S possibly damaging Het
Lrp8 T C 4: 107,834,755 probably null Het
Lrrc2 A T 9: 110,980,919 D341V probably damaging Het
Map4k4 A G 1: 40,007,502 K646R probably damaging Het
Mrps9 T A 1: 42,895,331 probably null Het
Olfr1130 T A 2: 87,607,711 C108S probably damaging Het
Olfr745 T A 14: 50,643,162 Y288N probably damaging Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pcnt A T 10: 76,399,945 C1401S possibly damaging Het
Pdgfrb A T 18: 61,077,668 K749M probably damaging Het
Pigo A T 4: 43,019,412 W969R probably null Het
Pigr A T 1: 130,844,699 Y218F probably damaging Het
Pih1d1 A G 7: 45,154,854 probably benign Het
Pik3cg A T 12: 32,199,196 probably null Het
Pik3r6 A T 11: 68,533,468 K300* probably null Het
Pip5k1c A G 10: 81,305,250 D64G probably damaging Het
Piwil2 A T 14: 70,421,593 I161K possibly damaging Het
Pou3f1 A G 4: 124,658,656 E317G probably damaging Het
Prdm8 C T 5: 98,185,212 Q213* probably null Het
Prpf6 T A 2: 181,650,106 C739S possibly damaging Het
Psmc3 T A 2: 91,054,608 S40T probably benign Het
Psmd3 A T 11: 98,682,824 D32V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rapgef6 A T 11: 54,691,381 H1373L possibly damaging Het
Rnf207 A C 4: 152,313,209 S328A probably benign Het
Ros1 C T 10: 52,128,416 probably null Het
Ryr2 T A 13: 11,587,254 I4581F possibly damaging Het
Sacm1l C T 9: 123,586,399 R480W probably damaging Het
Sec16a A G 2: 26,419,649 V664A probably benign Het
Selenoo T A 15: 89,092,766 M207K probably damaging Het
Sh3tc2 G A 18: 62,014,891 probably null Het
Slco2b1 G T 7: 99,660,049 Q692K probably benign Het
Slfn4 A T 11: 83,186,797 D137V probably damaging Het
Srrm2 G A 17: 23,820,618 A2175T probably damaging Het
Stard9 T A 2: 120,693,399 C692S probably benign Het
Sulf2 T A 2: 166,081,622 D559V probably benign Het
Tbpl2 T C 2: 24,087,158 I283V probably benign Het
Tmem19 A G 10: 115,359,761 F46S probably benign Het
Trp63 T A 16: 25,763,306 Y35N probably damaging Het
Ttn T A 2: 76,886,442 probably benign Het
Ube2z A T 11: 96,050,322 H331Q probably benign Het
Ubr1 C T 2: 120,911,997 probably null Het
Uhrf1bp1 A G 17: 27,886,864 E788G probably damaging Het
Vmn1r235 A T 17: 21,262,288 I292F possibly damaging Het
Vmn2r1 T A 3: 64,105,080 D787E probably damaging Het
Vmn2r3 A G 3: 64,259,799 V637A probably benign Het
Xpnpep1 C A 19: 53,006,175 V341L probably benign Het
Yme1l1 A G 2: 23,194,747 D619G probably damaging Het
Zfp597 G A 16: 3,866,638 P85S probably damaging Het
Zscan20 A G 4: 128,586,128 S857P probably benign Het
Other mutations in Catsperg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Catsperg2 APN 7 29705404 missense possibly damaging 0.86
IGL00095:Catsperg2 APN 7 29698058 missense possibly damaging 0.73
IGL00902:Catsperg2 APN 7 29701143 missense possibly damaging 0.93
IGL01667:Catsperg2 APN 7 29710133 missense probably damaging 0.98
IGL01791:Catsperg2 APN 7 29704665 splice site probably null
IGL01961:Catsperg2 APN 7 29721672 splice site probably benign
IGL02187:Catsperg2 APN 7 29721366 missense probably benign 0.02
IGL02605:Catsperg2 APN 7 29719565 missense possibly damaging 0.71
IGL03001:Catsperg2 APN 7 29725079 missense probably benign 0.32
IGL03228:Catsperg2 APN 7 29698225 missense probably damaging 0.96
IGL03239:Catsperg2 APN 7 29697716 missense probably benign 0.04
IGL03242:Catsperg2 APN 7 29725479 unclassified probably benign
IGL03247:Catsperg2 APN 7 29717048 missense possibly damaging 0.71
IGL03256:Catsperg2 APN 7 29709874 missense probably damaging 0.99
PIT4520001:Catsperg2 UTSW 7 29710161 missense possibly damaging 0.93
R0052:Catsperg2 UTSW 7 29725020 splice site probably benign
R0281:Catsperg2 UTSW 7 29706571 missense possibly damaging 0.86
R0357:Catsperg2 UTSW 7 29714901 missense possibly damaging 0.93
R0480:Catsperg2 UTSW 7 29721298 missense probably damaging 0.98
R0578:Catsperg2 UTSW 7 29704691 missense possibly damaging 0.71
R0732:Catsperg2 UTSW 7 29700696 missense probably damaging 1.00
R0826:Catsperg2 UTSW 7 29705624 missense possibly damaging 0.92
R1535:Catsperg2 UTSW 7 29698246 missense possibly damaging 0.85
R1925:Catsperg2 UTSW 7 29697764 missense probably benign 0.01
R1990:Catsperg2 UTSW 7 29721045 nonsense probably null
R3433:Catsperg2 UTSW 7 29701218 missense possibly damaging 0.71
R3721:Catsperg2 UTSW 7 29705102 missense probably benign 0.02
R4020:Catsperg2 UTSW 7 29717004 missense probably damaging 0.99
R4760:Catsperg2 UTSW 7 29705635 missense probably damaging 0.99
R4829:Catsperg2 UTSW 7 29701125 missense probably damaging 0.98
R5093:Catsperg2 UTSW 7 29716998 missense probably benign 0.32
R5266:Catsperg2 UTSW 7 29717066 missense probably damaging 0.98
R5267:Catsperg2 UTSW 7 29717066 missense probably damaging 0.98
R5287:Catsperg2 UTSW 7 29697838 missense possibly damaging 0.96
R5427:Catsperg2 UTSW 7 29714850 missense possibly damaging 0.71
R5575:Catsperg2 UTSW 7 29705590 missense possibly damaging 0.84
R5685:Catsperg2 UTSW 7 29701188 missense probably damaging 1.00
R5844:Catsperg2 UTSW 7 29697832 missense possibly damaging 0.96
R5982:Catsperg2 UTSW 7 29713017 missense possibly damaging 0.51
R6662:Catsperg2 UTSW 7 29719513 start gained probably benign
R6744:Catsperg2 UTSW 7 29709819 missense probably benign 0.23
R7171:Catsperg2 UTSW 7 29705325 missense possibly damaging 0.71
R7239:Catsperg2 UTSW 7 29710082 missense probably benign 0.00
R7336:Catsperg2 UTSW 7 29706601 missense possibly damaging 0.83
R7498:Catsperg2 UTSW 7 29717102 missense possibly damaging 0.71
R7548:Catsperg2 UTSW 7 29709826 missense probably benign 0.32
R7562:Catsperg2 UTSW 7 29697719 missense probably benign 0.18
R7565:Catsperg2 UTSW 7 29712981 missense probably null 0.71
R7600:Catsperg2 UTSW 7 29704858 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GAAACCTCCTTGTAGCTCCC -3'
(R):5'- AAATCTTCCTGCCCTGTCAGG -3'

Sequencing Primer
(F):5'- GTAGCTCCCAACCTGCTC -3'
(R):5'- GTCAGTAGAAGGCGCTACC -3'
Posted On2016-06-06