Incidental Mutation 'R5033:Olfr898'
ID389373
Institutional Source Beutler Lab
Gene Symbol Olfr898
Ensembl Gene ENSMUSG00000094588
Gene Nameolfactory receptor 898
SynonymsGA_x6K02T2PVTD-32037624-32038565, MOR170-3
MMRRC Submission 042624-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R5033 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38348411-38352919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38349628 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 176 (H176Y)
Ref Sequence ENSEMBL: ENSMUSP00000149554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076504] [ENSMUST00000216304] [ENSMUST00000217063]
Predicted Effect probably damaging
Transcript: ENSMUST00000076504
AA Change: H182Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075824
Gene: ENSMUSG00000094588
AA Change: H182Y

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 2.2e-47 PFAM
Pfam:7tm_1 47 313 1.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216304
AA Change: H176Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217063
AA Change: H176Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,279,414 V149A probably benign Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4931406P16Rik C T 7: 34,245,812 G336S probably benign Het
9930111J21Rik1 G A 11: 48,947,706 R685W probably damaging Het
Arhgap10 A T 8: 77,382,757 L399H probably damaging Het
Arih2 AGCCG AG 9: 108,611,660 probably benign Het
Atp13a2 A G 4: 141,000,821 H575R possibly damaging Het
Bbof1 G A 12: 84,411,270 probably null Het
Catsperg2 A C 7: 29,710,134 Y545D possibly damaging Het
Cdc42bpa T A 1: 180,065,015 I248N probably damaging Het
Cdk11b A T 4: 155,648,825 probably benign Het
Cfap46 C A 7: 139,603,860 L90F probably benign Het
Cndp2 A G 18: 84,670,829 L276P possibly damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Daam1 C A 12: 71,946,520 H354Q unknown Het
Dnah5 T A 15: 28,421,678 F3892Y probably damaging Het
Dnajb3 A G 1: 88,205,023 V219A possibly damaging Het
Drd5 A G 5: 38,320,201 H179R probably damaging Het
Dym A G 18: 75,119,161 N333D possibly damaging Het
Eif2b3 A G 4: 117,052,736 D156G probably damaging Het
Emc1 A G 4: 139,371,696 D830G probably damaging Het
F13a1 A C 13: 36,988,856 I183M probably damaging Het
Fam136b-ps T A 15: 31,276,897 probably benign Het
Fdft1 C A 14: 63,163,404 K93N probably damaging Het
Gcc2 A G 10: 58,278,806 D959G probably damaging Het
Gm14085 T A 2: 122,522,914 probably null Het
Gm853 C T 4: 130,221,615 probably null Het
Gp2 A G 7: 119,454,291 V149A probably damaging Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Hdac9 A T 12: 34,373,907 C587S probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Iars2 A G 1: 185,317,928 V453A possibly damaging Het
Il1r1 T G 1: 40,293,524 C121W probably damaging Het
Jazf1 A G 6: 52,777,540 Y184H probably damaging Het
Kel A T 6: 41,699,055 Y234N probably damaging Het
Khk G A 5: 30,929,660 G186D probably damaging Het
Klf4 A T 4: 55,530,301 M270K probably benign Het
Kmt2c G A 5: 25,314,708 L2135F probably benign Het
Krtap15 A G 16: 88,829,156 Y37C probably damaging Het
Lars A G 18: 42,214,776 F994S possibly damaging Het
Lrp8 T C 4: 107,834,755 probably null Het
Lrrc2 A T 9: 110,980,919 D341V probably damaging Het
Map4k4 A G 1: 40,007,502 K646R probably damaging Het
Mrps9 T A 1: 42,895,331 probably null Het
Olfr1130 T A 2: 87,607,711 C108S probably damaging Het
Olfr745 T A 14: 50,643,162 Y288N probably damaging Het
Pcnt A T 10: 76,399,945 C1401S possibly damaging Het
Pdgfrb A T 18: 61,077,668 K749M probably damaging Het
Pigo A T 4: 43,019,412 W969R probably null Het
Pigr A T 1: 130,844,699 Y218F probably damaging Het
Pih1d1 A G 7: 45,154,854 probably benign Het
Pik3cg A T 12: 32,199,196 probably null Het
Pik3r6 A T 11: 68,533,468 K300* probably null Het
Pip5k1c A G 10: 81,305,250 D64G probably damaging Het
Piwil2 A T 14: 70,421,593 I161K possibly damaging Het
Pou3f1 A G 4: 124,658,656 E317G probably damaging Het
Prdm8 C T 5: 98,185,212 Q213* probably null Het
Prpf6 T A 2: 181,650,106 C739S possibly damaging Het
Psmc3 T A 2: 91,054,608 S40T probably benign Het
Psmd3 A T 11: 98,682,824 D32V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rapgef6 A T 11: 54,691,381 H1373L possibly damaging Het
Rnf207 A C 4: 152,313,209 S328A probably benign Het
Ros1 C T 10: 52,128,416 probably null Het
Ryr2 T A 13: 11,587,254 I4581F possibly damaging Het
Sacm1l C T 9: 123,586,399 R480W probably damaging Het
Sec16a A G 2: 26,419,649 V664A probably benign Het
Selenoo T A 15: 89,092,766 M207K probably damaging Het
Sh3tc2 G A 18: 62,014,891 probably null Het
Slco2b1 G T 7: 99,660,049 Q692K probably benign Het
Slfn4 A T 11: 83,186,797 D137V probably damaging Het
Srrm2 G A 17: 23,820,618 A2175T probably damaging Het
Stard9 T A 2: 120,693,399 C692S probably benign Het
Sulf2 T A 2: 166,081,622 D559V probably benign Het
Tbpl2 T C 2: 24,087,158 I283V probably benign Het
Tmem19 A G 10: 115,359,761 F46S probably benign Het
Trp63 T A 16: 25,763,306 Y35N probably damaging Het
Ttn T A 2: 76,886,442 probably benign Het
Ube2z A T 11: 96,050,322 H331Q probably benign Het
Ubr1 C T 2: 120,911,997 probably null Het
Uhrf1bp1 A G 17: 27,886,864 E788G probably damaging Het
Vmn1r235 A T 17: 21,262,288 I292F possibly damaging Het
Vmn2r1 T A 3: 64,105,080 D787E probably damaging Het
Vmn2r3 A G 3: 64,259,799 V637A probably benign Het
Xpnpep1 C A 19: 53,006,175 V341L probably benign Het
Yme1l1 A G 2: 23,194,747 D619G probably damaging Het
Zfp597 G A 16: 3,866,638 P85S probably damaging Het
Zscan20 A G 4: 128,586,128 S857P probably benign Het
Other mutations in Olfr898
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Olfr898 APN 9 38349805 missense possibly damaging 0.95
IGL02477:Olfr898 APN 9 38349125 missense probably benign 0.16
IGL02858:Olfr898 APN 9 38349173 missense probably benign 0.04
PIT4362001:Olfr898 UTSW 9 38349198 missense probably benign 0.34
R0060:Olfr898 UTSW 9 38349512 missense probably benign 0.23
R0518:Olfr898 UTSW 9 38349203 missense probably damaging 0.99
R0521:Olfr898 UTSW 9 38349203 missense probably damaging 0.99
R0622:Olfr898 UTSW 9 38349371 missense possibly damaging 0.74
R0898:Olfr898 UTSW 9 38349442 missense probably damaging 0.97
R1562:Olfr898 UTSW 9 38349362 nonsense probably null
R3903:Olfr898 UTSW 9 38349658 nonsense probably null
R4375:Olfr898 UTSW 9 38349169 missense probably benign
R4459:Olfr898 UTSW 9 38349992 missense probably damaging 1.00
R4762:Olfr898 UTSW 9 38349281 missense probably damaging 1.00
R4943:Olfr898 UTSW 9 38349628 missense probably damaging 1.00
R5442:Olfr898 UTSW 9 38349862 missense probably benign 0.06
R5863:Olfr898 UTSW 9 38349787 missense probably benign 0.09
R5988:Olfr898 UTSW 9 38349749 missense probably benign 0.30
R7077:Olfr898 UTSW 9 38349970 missense probably damaging 1.00
R7509:Olfr898 UTSW 9 38349572 missense probably benign 0.26
R7709:Olfr898 UTSW 9 38349277 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAGCCATGGCCTATGATCG -3'
(R):5'- TAACAGTTATGATGTGGGACCC -3'

Sequencing Primer
(F):5'- AGCCATGGCCTATGATCGCTATG -3'
(R):5'- GGCTTTTGACCAACCCTTACTTGATG -3'
Posted On2016-06-06