Mutagenetix > Incidental Mutation

Incidental Mutation 'R5033:Pik3cg'

389391

Institutional Source

Beutler Lab

Gene Symbol

Pik3cg

Ensembl Gene

ENSMUSG00000020573

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma

Synonyms

PI(3)Kgamma, p110gamma, 5830428L06Rik, PI3K, PI3Kgamma

MMRRC Submission

042624-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5033 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32173473-32208659 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 32199196 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053215] [ENSMUST00000085469] [ENSMUST00000156904] [ENSMUST00000217915] [ENSMUST00000220366]

AlphaFold

Q9JHG7

Predicted Effect

probably null
Transcript: ENSMUST00000053215

SMART Domains

Protein: ENSMUSP00000062864
Gene: ENSMUSG00000020573

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000085469

SMART Domains

Protein: ENSMUSP00000082596
Gene: ENSMUSG00000020573

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126814

Predicted Effect

probably benign
Transcript: ENSMUST00000156904

SMART Domains

Protein: ENSMUSP00000123539
Gene: ENSMUSG00000020573

Domain	Start	End	E-Value	Type
PI3K_rbd	203	312	3.56e-43	SMART
PI3K_C2	349	452	1.15e-28	SMART
PI3Ka	541	733	4.41e-89	SMART
PI3Kc	829	1094	3.9e-131	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000217915

Predicted Effect

probably null
Transcript: ENSMUST00000220366

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphoinositide 3-kinases (PI3Ks) phosphorylate inositol lipids and are involved in the immune response. The protein encoded by this gene is a class I catalytic subunit of PI3K. Like other class I catalytic subunits (p110-alpha p110-beta, and p110-delta), the encoded protein binds a p85 regulatory subunit to form PI3K. This gene is located in a commonly deleted segment of chromosome 7 previously identified in myeloid leukemias. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in thymocyte development, T cell activation, and neutrophil migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,279,414	V149A	probably benign	Het
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
4931406P16Rik	C	T	7: 34,245,812	G336S	probably benign	Het
9930111J21Rik1	G	A	11: 48,947,706	R685W	probably damaging	Het
Arhgap10	A	T	8: 77,382,757	L399H	probably damaging	Het
Arih2	AGCCG	AG	9: 108,611,660		probably benign	Het
Atp13a2	A	G	4: 141,000,821	H575R	possibly damaging	Het
Bbof1	G	A	12: 84,411,270		probably null	Het
Catsperg2	A	C	7: 29,710,134	Y545D	possibly damaging	Het
Cdc42bpa	T	A	1: 180,065,015	I248N	probably damaging	Het
Cdk11b	A	T	4: 155,648,825		probably benign	Het
Cfap46	C	A	7: 139,603,860	L90F	probably benign	Het
Cndp2	A	G	18: 84,670,829	L276P	possibly damaging	Het
Col3a1	A	C	1: 45,346,110	D129A	probably damaging	Het
Daam1	C	A	12: 71,946,520	H354Q	unknown	Het
Dnah5	T	A	15: 28,421,678	F3892Y	probably damaging	Het
Dnajb3	A	G	1: 88,205,023	V219A	possibly damaging	Het
Drd5	A	G	5: 38,320,201	H179R	probably damaging	Het
Dym	A	G	18: 75,119,161	N333D	possibly damaging	Het
Eif2b3	A	G	4: 117,052,736	D156G	probably damaging	Het
Emc1	A	G	4: 139,371,696	D830G	probably damaging	Het
F13a1	A	C	13: 36,988,856	I183M	probably damaging	Het
Fam136b-ps	T	A	15: 31,276,897		probably benign	Het
Fdft1	C	A	14: 63,163,404	K93N	probably damaging	Het
Gcc2	A	G	10: 58,278,806	D959G	probably damaging	Het
Gm14085	T	A	2: 122,522,914		probably null	Het
Gm853	C	T	4: 130,221,615		probably null	Het
Gp2	A	G	7: 119,454,291	V149A	probably damaging	Het
Gpc1	G	A	1: 92,857,029	G308D	probably damaging	Het
Hdac9	A	T	12: 34,373,907	C587S	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Iars2	A	G	1: 185,317,928	V453A	possibly damaging	Het
Il1r1	T	G	1: 40,293,524	C121W	probably damaging	Het
Jazf1	A	G	6: 52,777,540	Y184H	probably damaging	Het
Kel	A	T	6: 41,699,055	Y234N	probably damaging	Het
Khk	G	A	5: 30,929,660	G186D	probably damaging	Het
Klf4	A	T	4: 55,530,301	M270K	probably benign	Het
Kmt2c	G	A	5: 25,314,708	L2135F	probably benign	Het
Krtap15	A	G	16: 88,829,156	Y37C	probably damaging	Het
Lars	A	G	18: 42,214,776	F994S	possibly damaging	Het
Lrp8	T	C	4: 107,834,755		probably null	Het
Lrrc2	A	T	9: 110,980,919	D341V	probably damaging	Het
Map4k4	A	G	1: 40,007,502	K646R	probably damaging	Het
Mrps9	T	A	1: 42,895,331		probably null	Het
Olfr1130	T	A	2: 87,607,711	C108S	probably damaging	Het
Olfr745	T	A	14: 50,643,162	Y288N	probably damaging	Het
Olfr898	C	T	9: 38,349,628	H176Y	probably damaging	Het
Pcnt	A	T	10: 76,399,945	C1401S	possibly damaging	Het
Pdgfrb	A	T	18: 61,077,668	K749M	probably damaging	Het
Pigo	A	T	4: 43,019,412	W969R	probably null	Het
Pigr	A	T	1: 130,844,699	Y218F	probably damaging	Het
Pih1d1	A	G	7: 45,154,854		probably benign	Het
Pik3r6	A	T	11: 68,533,468	K300*	probably null	Het
Pip5k1c	A	G	10: 81,305,250	D64G	probably damaging	Het
Piwil2	A	T	14: 70,421,593	I161K	possibly damaging	Het
Pou3f1	A	G	4: 124,658,656	E317G	probably damaging	Het
Prdm8	C	T	5: 98,185,212	Q213*	probably null	Het
Prpf6	T	A	2: 181,650,106	C739S	possibly damaging	Het
Psmc3	T	A	2: 91,054,608	S40T	probably benign	Het
Psmd3	A	T	11: 98,682,824	D32V	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rapgef6	A	T	11: 54,691,381	H1373L	possibly damaging	Het
Rnf207	A	C	4: 152,313,209	S328A	probably benign	Het
Ros1	C	T	10: 52,128,416		probably null	Het
Ryr2	T	A	13: 11,587,254	I4581F	possibly damaging	Het
Sacm1l	C	T	9: 123,586,399	R480W	probably damaging	Het
Sec16a	A	G	2: 26,419,649	V664A	probably benign	Het
Selenoo	T	A	15: 89,092,766	M207K	probably damaging	Het
Sh3tc2	G	A	18: 62,014,891		probably null	Het
Slco2b1	G	T	7: 99,660,049	Q692K	probably benign	Het
Slfn4	A	T	11: 83,186,797	D137V	probably damaging	Het
Srrm2	G	A	17: 23,820,618	A2175T	probably damaging	Het
Stard9	T	A	2: 120,693,399	C692S	probably benign	Het
Sulf2	T	A	2: 166,081,622	D559V	probably benign	Het
Tbpl2	T	C	2: 24,087,158	I283V	probably benign	Het
Tmem19	A	G	10: 115,359,761	F46S	probably benign	Het
Trp63	T	A	16: 25,763,306	Y35N	probably damaging	Het
Ttn	T	A	2: 76,886,442		probably benign	Het
Ube2z	A	T	11: 96,050,322	H331Q	probably benign	Het
Ubr1	C	T	2: 120,911,997		probably null	Het
Uhrf1bp1	A	G	17: 27,886,864	E788G	probably damaging	Het
Vmn1r235	A	T	17: 21,262,288	I292F	possibly damaging	Het
Vmn2r1	T	A	3: 64,105,080	D787E	probably damaging	Het
Vmn2r3	A	G	3: 64,259,799	V637A	probably benign	Het
Xpnpep1	C	A	19: 53,006,175	V341L	probably benign	Het
Yme1l1	A	G	2: 23,194,747	D619G	probably damaging	Het
Zfp597	G	A	16: 3,866,638	P85S	probably damaging	Het
Zscan20	A	G	4: 128,586,128	S857P	probably benign	Het

Other mutations in Pik3cg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Pik3cg	APN	12	32205149	missense	probably damaging	1.00
IGL02182:Pik3cg	APN	12	32205273	missense	possibly damaging	0.90
IGL02273:Pik3cg	APN	12	32176810	missense	probably damaging	1.00
IGL02312:Pik3cg	APN	12	32194821	missense	possibly damaging	0.55
IGL02752:Pik3cg	APN	12	32204263	missense	probably damaging	1.00
IGL03107:Pik3cg	APN	12	32200595	missense	probably damaging	1.00
IGL03139:Pik3cg	APN	12	32192223	missense	probably damaging	1.00
IGL03267:Pik3cg	APN	12	32205308	missense	possibly damaging	0.94
IGL03367:Pik3cg	APN	12	32192121	missense	probably benign	0.01
PIT4283001:Pik3cg	UTSW	12	32205865	missense	probably damaging	1.00
PIT4472001:Pik3cg	UTSW	12	32204984	missense	probably damaging	0.99
PIT4514001:Pik3cg	UTSW	12	32204903	missense	probably damaging	1.00
R0112:Pik3cg	UTSW	12	32195715	splice site	probably benign
R0145:Pik3cg	UTSW	12	32204322	missense	probably benign	0.20
R0279:Pik3cg	UTSW	12	32204791	missense	probably damaging	1.00
R0471:Pik3cg	UTSW	12	32194771	missense	probably damaging	0.99
R0494:Pik3cg	UTSW	12	32204546	missense	possibly damaging	0.84
R0573:Pik3cg	UTSW	12	32197197	missense	probably damaging	1.00
R0631:Pik3cg	UTSW	12	32205203	missense	probably benign
R0699:Pik3cg	UTSW	12	32197342	splice site	probably benign
R0826:Pik3cg	UTSW	12	32195673	missense	possibly damaging	0.78
R1076:Pik3cg	UTSW	12	32195714	splice site	probably benign
R1101:Pik3cg	UTSW	12	32195646	missense	probably null	0.98
R1459:Pik3cg	UTSW	12	32204984	missense	probably damaging	0.99
R1625:Pik3cg	UTSW	12	32194742	missense	probably damaging	1.00
R1971:Pik3cg	UTSW	12	32192153	missense	probably damaging	1.00
R1992:Pik3cg	UTSW	12	32204025	missense	possibly damaging	0.83
R2109:Pik3cg	UTSW	12	32193710	missense	possibly damaging	0.75
R2319:Pik3cg	UTSW	12	32176736	missense	probably damaging	0.99
R3421:Pik3cg	UTSW	12	32204739	missense	probably damaging	1.00
R3422:Pik3cg	UTSW	12	32204739	missense	probably damaging	1.00
R3740:Pik3cg	UTSW	12	32205224	missense	probably damaging	1.00
R3777:Pik3cg	UTSW	12	32194709	missense	probably damaging	0.98
R4300:Pik3cg	UTSW	12	32176672	missense	probably damaging	1.00
R4395:Pik3cg	UTSW	12	32204092	missense	probably damaging	1.00
R4725:Pik3cg	UTSW	12	32193597	critical splice donor site	probably null
R4785:Pik3cg	UTSW	12	32205199	missense	probably damaging	0.97
R4809:Pik3cg	UTSW	12	32204081	missense	possibly damaging	0.46
R4981:Pik3cg	UTSW	12	32204104	missense	possibly damaging	0.77
R5161:Pik3cg	UTSW	12	32204978	missense	possibly damaging	0.92
R5806:Pik3cg	UTSW	12	32204953	missense	possibly damaging	0.88
R6136:Pik3cg	UTSW	12	32204359	missense	probably benign	0.00
R6746:Pik3cg	UTSW	12	32194758	missense	probably damaging	1.00
R6895:Pik3cg	UTSW	12	32204347	missense	possibly damaging	0.87
R7000:Pik3cg	UTSW	12	32192129	missense	probably damaging	1.00
R7089:Pik3cg	UTSW	12	32176846	missense	probably benign	0.00
R7113:Pik3cg	UTSW	12	32205667	missense	probably damaging	0.98
R7372:Pik3cg	UTSW	12	32197197	missense	probably damaging	1.00
R7483:Pik3cg	UTSW	12	32195648	missense	probably damaging	0.99
R7596:Pik3cg	UTSW	12	32204741	missense	probably damaging	1.00
R7771:Pik3cg	UTSW	12	32204014	missense	probably benign
R7910:Pik3cg	UTSW	12	32200517	missense	probably benign	0.16
R7974:Pik3cg	UTSW	12	32204032	missense	probably benign	0.00
R8084:Pik3cg	UTSW	12	32195688	missense	probably benign	0.30
R8352:Pik3cg	UTSW	12	32193640	missense	probably damaging	1.00
R8452:Pik3cg	UTSW	12	32193640	missense	probably damaging	1.00
R8720:Pik3cg	UTSW	12	32193689	missense	probably benign	0.09
R8757:Pik3cg	UTSW	12	32205007	missense	probably damaging	1.00
R8911:Pik3cg	UTSW	12	32197258	missense	probably benign
R9052:Pik3cg	UTSW	12	32195709	missense	possibly damaging	0.91
R9166:Pik3cg	UTSW	12	32192214	missense	probably damaging	1.00
R9209:Pik3cg	UTSW	12	32197313	missense	probably damaging	0.99
Z1176:Pik3cg	UTSW	12	32204795	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACTTGACCGAAGCCCATC -3'
(R):5'- CCTACTTGGAATGGTTAGATCCC -3'

Sequencing Primer
(F):5'- CTGAAGATCCATTGTGAAGGTCC -3'
(R):5'- CTTGGAATGGTTAGATCCCCAAAG -3'

Posted On

2016-06-06