Incidental Mutation 'R5033:Hdac9'
ID 389392
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Name histone deacetylase 9
Synonyms Hdac7b, HDRP, Mitr, D030072B18Rik
MMRRC Submission 042624-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5033 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 34047580-34917095 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34373907 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 587 (C587S)
Ref Sequence ENSEMBL: ENSMUSP00000148224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110819] [ENSMUST00000209667] [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000210724] [ENSMUST00000211107] [ENSMUST00000211752]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000110819
AA Change: C563S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106443
Gene: ENSMUSG00000004698
AA Change: C563S

DomainStartEndE-ValueType
Pfam:HDAC4_Gln 37 124 5.4e-36 PFAM
low complexity region 260 284 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 389 400 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209667
AA Change: C519S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209750
AA Change: C566S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209902
AA Change: C563S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000209990
AA Change: C522S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210724
Predicted Effect probably benign
Transcript: ENSMUST00000211107
AA Change: C535S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211752
AA Change: C587S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,279,414 V149A probably benign Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4931406P16Rik C T 7: 34,245,812 G336S probably benign Het
9930111J21Rik1 G A 11: 48,947,706 R685W probably damaging Het
Arhgap10 A T 8: 77,382,757 L399H probably damaging Het
Arih2 AGCCG AG 9: 108,611,660 probably benign Het
Atp13a2 A G 4: 141,000,821 H575R possibly damaging Het
Bbof1 G A 12: 84,411,270 probably null Het
Catsperg2 A C 7: 29,710,134 Y545D possibly damaging Het
Cdc42bpa T A 1: 180,065,015 I248N probably damaging Het
Cdk11b A T 4: 155,648,825 probably benign Het
Cfap46 C A 7: 139,603,860 L90F probably benign Het
Cndp2 A G 18: 84,670,829 L276P possibly damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Daam1 C A 12: 71,946,520 H354Q unknown Het
Dnah5 T A 15: 28,421,678 F3892Y probably damaging Het
Dnajb3 A G 1: 88,205,023 V219A possibly damaging Het
Drd5 A G 5: 38,320,201 H179R probably damaging Het
Dym A G 18: 75,119,161 N333D possibly damaging Het
Eif2b3 A G 4: 117,052,736 D156G probably damaging Het
Emc1 A G 4: 139,371,696 D830G probably damaging Het
F13a1 A C 13: 36,988,856 I183M probably damaging Het
Fam136b-ps T A 15: 31,276,897 probably benign Het
Fdft1 C A 14: 63,163,404 K93N probably damaging Het
Gcc2 A G 10: 58,278,806 D959G probably damaging Het
Gm14085 T A 2: 122,522,914 probably null Het
Gm853 C T 4: 130,221,615 probably null Het
Gp2 A G 7: 119,454,291 V149A probably damaging Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Iars2 A G 1: 185,317,928 V453A possibly damaging Het
Il1r1 T G 1: 40,293,524 C121W probably damaging Het
Jazf1 A G 6: 52,777,540 Y184H probably damaging Het
Kel A T 6: 41,699,055 Y234N probably damaging Het
Khk G A 5: 30,929,660 G186D probably damaging Het
Klf4 A T 4: 55,530,301 M270K probably benign Het
Kmt2c G A 5: 25,314,708 L2135F probably benign Het
Krtap15 A G 16: 88,829,156 Y37C probably damaging Het
Lars A G 18: 42,214,776 F994S possibly damaging Het
Lrp8 T C 4: 107,834,755 probably null Het
Lrrc2 A T 9: 110,980,919 D341V probably damaging Het
Map4k4 A G 1: 40,007,502 K646R probably damaging Het
Mrps9 T A 1: 42,895,331 probably null Het
Olfr1130 T A 2: 87,607,711 C108S probably damaging Het
Olfr745 T A 14: 50,643,162 Y288N probably damaging Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pcnt A T 10: 76,399,945 C1401S possibly damaging Het
Pdgfrb A T 18: 61,077,668 K749M probably damaging Het
Pigo A T 4: 43,019,412 W969R probably null Het
Pigr A T 1: 130,844,699 Y218F probably damaging Het
Pih1d1 A G 7: 45,154,854 probably benign Het
Pik3cg A T 12: 32,199,196 probably null Het
Pik3r6 A T 11: 68,533,468 K300* probably null Het
Pip5k1c A G 10: 81,305,250 D64G probably damaging Het
Piwil2 A T 14: 70,421,593 I161K possibly damaging Het
Pou3f1 A G 4: 124,658,656 E317G probably damaging Het
Prdm8 C T 5: 98,185,212 Q213* probably null Het
Prpf6 T A 2: 181,650,106 C739S possibly damaging Het
Psmc3 T A 2: 91,054,608 S40T probably benign Het
Psmd3 A T 11: 98,682,824 D32V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rapgef6 A T 11: 54,691,381 H1373L possibly damaging Het
Rnf207 A C 4: 152,313,209 S328A probably benign Het
Ros1 C T 10: 52,128,416 probably null Het
Ryr2 T A 13: 11,587,254 I4581F possibly damaging Het
Sacm1l C T 9: 123,586,399 R480W probably damaging Het
Sec16a A G 2: 26,419,649 V664A probably benign Het
Selenoo T A 15: 89,092,766 M207K probably damaging Het
Sh3tc2 G A 18: 62,014,891 probably null Het
Slco2b1 G T 7: 99,660,049 Q692K probably benign Het
Slfn4 A T 11: 83,186,797 D137V probably damaging Het
Srrm2 G A 17: 23,820,618 A2175T probably damaging Het
Stard9 T A 2: 120,693,399 C692S probably benign Het
Sulf2 T A 2: 166,081,622 D559V probably benign Het
Tbpl2 T C 2: 24,087,158 I283V probably benign Het
Tmem19 A G 10: 115,359,761 F46S probably benign Het
Trp63 T A 16: 25,763,306 Y35N probably damaging Het
Ttn T A 2: 76,886,442 probably benign Het
Ube2z A T 11: 96,050,322 H331Q probably benign Het
Ubr1 C T 2: 120,911,997 probably null Het
Uhrf1bp1 A G 17: 27,886,864 E788G probably damaging Het
Vmn1r235 A T 17: 21,262,288 I292F possibly damaging Het
Vmn2r1 T A 3: 64,105,080 D787E probably damaging Het
Vmn2r3 A G 3: 64,259,799 V637A probably benign Het
Xpnpep1 C A 19: 53,006,175 V341L probably benign Het
Yme1l1 A G 2: 23,194,747 D619G probably damaging Het
Zfp597 G A 16: 3,866,638 P85S probably damaging Het
Zscan20 A G 4: 128,586,128 S857P probably benign Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34429489 splice site probably benign
IGL01484:Hdac9 APN 12 34437165 missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34431945 missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34431968 missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34431926 missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34393274 splice site probably benign
IGL03202:Hdac9 APN 12 34373951 missense probably damaging 1.00
PIT4468001:Hdac9 UTSW 12 34095934 missense unknown
R0304:Hdac9 UTSW 12 34374111 missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R0659:Hdac9 UTSW 12 34437222 missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34429492 splice site probably benign
R1879:Hdac9 UTSW 12 34390333 missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34429545 missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34389332 missense probably damaging 1.00
R2151:Hdac9 UTSW 12 34390256 missense probably damaging 1.00
R2216:Hdac9 UTSW 12 34429517 missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2225:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R2227:Hdac9 UTSW 12 34407802 missense probably benign 0.09
R3500:Hdac9 UTSW 12 34437353 missense probably benign 0.01
R4441:Hdac9 UTSW 12 34389376 missense probably damaging 1.00
R4674:Hdac9 UTSW 12 34373960 missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34437247 missense probably damaging 1.00
R5229:Hdac9 UTSW 12 34437164 missense probably damaging 1.00
R5353:Hdac9 UTSW 12 34393393 nonsense probably null
R5384:Hdac9 UTSW 12 34429558 missense probably damaging 1.00
R5958:Hdac9 UTSW 12 34373883 missense probably damaging 0.97
R6129:Hdac9 UTSW 12 34287475 missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34389429 missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34528294 missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34052324 missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34431991 critical splice acceptor site probably null
R6589:Hdac9 UTSW 12 34215029 missense probably damaging 1.00
R6737:Hdac9 UTSW 12 34215452 missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34287529 missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34287464 missense probably benign 0.12
R6857:Hdac9 UTSW 12 34393363 missense probably benign 0.37
R7069:Hdac9 UTSW 12 34429549 missense possibly damaging 0.92
R7237:Hdac9 UTSW 12 34374140 critical splice acceptor site probably null
R7768:Hdac9 UTSW 12 34390240 missense possibly damaging 0.81
R7917:Hdac9 UTSW 12 34433210 missense probably benign 0.31
R7974:Hdac9 UTSW 12 34303220 missense possibly damaging 0.87
R7990:Hdac9 UTSW 12 34215453 missense probably benign 0.05
R8489:Hdac9 UTSW 12 34437181 missense probably damaging 1.00
R8683:Hdac9 UTSW 12 34390221 missense probably damaging 1.00
R9208:Hdac9 UTSW 12 34170102 missense probably benign 0.01
R9397:Hdac9 UTSW 12 34303276 missense probably damaging 0.99
R9431:Hdac9 UTSW 12 34390328 nonsense probably null
Z1088:Hdac9 UTSW 12 34407789 missense probably damaging 1.00
Z1176:Hdac9 UTSW 12 34373987 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGAATCCTGATACCCATTCAGAG -3'
(R):5'- CCACCTTGAAGAAGCAGAGG -3'

Sequencing Primer
(F):5'- CCCATTCAGAGATCAGTATAGAGTG -3'
(R):5'- GAGGAGCTTCAGGGGGAC -3'
Posted On 2016-06-06