Incidental Mutation 'R5033:Trp63'
ID 389407
Institutional Source Beutler Lab
Gene Symbol Trp63
Ensembl Gene ENSMUSG00000022510
Gene Name transformation related protein 63
Synonyms TAp63, deltaNp63, p63, p73L, p51/p63, KET protein, Trp53rp1
MMRRC Submission 042624-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock # R5033 (G1)
Quality Score 220
Status Not validated
Chromosome 16
Chromosomal Location 25683763-25892102 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25763306 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 35 (Y35N)
Ref Sequence ENSEMBL: ENSMUSP00000110962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065523] [ENSMUST00000115307] [ENSMUST00000115308] [ENSMUST00000115310]
AlphaFold O88898
Predicted Effect probably benign
Transcript: ENSMUST00000065523
AA Change: Y35N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067005
Gene: ENSMUSG00000022510
AA Change: Y35N

DomainStartEndE-ValueType
Pfam:P53 163 359 4.9e-110 PFAM
Pfam:P53_tetramer 391 432 2.2e-20 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115307
AA Change: Y35N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110962
Gene: ENSMUSG00000022510
AA Change: Y35N

DomainStartEndE-ValueType
Pfam:P53 163 200 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115308
AA Change: Y35N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110963
Gene: ENSMUSG00000022510
AA Change: Y35N

DomainStartEndE-ValueType
Pfam:P53 163 359 3.6e-110 PFAM
Pfam:P53_tetramer 387 428 1.8e-20 PFAM
low complexity region 433 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115310
AA Change: Y35N

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110965
Gene: ENSMUSG00000022510
AA Change: Y35N

DomainStartEndE-ValueType
Pfam:P53 163 359 1.3e-112 PFAM
Pfam:P53_tetramer 391 431 7e-21 PFAM
low complexity region 437 450 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
SAM 541 607 1.4e-7 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygotes for null mutations lack hair follicles, teeth, eyelids, and all squamous epithelia and derivatives including mammary, lacrymal, salivary, and prostate glands. Mutants have craniofacial anomalies, missing or truncated limbs, and small genitalia, and they die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,279,414 V149A probably benign Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4931406P16Rik C T 7: 34,245,812 G336S probably benign Het
9930111J21Rik1 G A 11: 48,947,706 R685W probably damaging Het
Arhgap10 A T 8: 77,382,757 L399H probably damaging Het
Arih2 AGCCG AG 9: 108,611,660 probably benign Het
Atp13a2 A G 4: 141,000,821 H575R possibly damaging Het
Bbof1 G A 12: 84,411,270 probably null Het
Catsperg2 A C 7: 29,710,134 Y545D possibly damaging Het
Cdc42bpa T A 1: 180,065,015 I248N probably damaging Het
Cdk11b A T 4: 155,648,825 probably benign Het
Cfap46 C A 7: 139,603,860 L90F probably benign Het
Cndp2 A G 18: 84,670,829 L276P possibly damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Daam1 C A 12: 71,946,520 H354Q unknown Het
Dnah5 T A 15: 28,421,678 F3892Y probably damaging Het
Dnajb3 A G 1: 88,205,023 V219A possibly damaging Het
Drd5 A G 5: 38,320,201 H179R probably damaging Het
Dym A G 18: 75,119,161 N333D possibly damaging Het
Eif2b3 A G 4: 117,052,736 D156G probably damaging Het
Emc1 A G 4: 139,371,696 D830G probably damaging Het
F13a1 A C 13: 36,988,856 I183M probably damaging Het
Fam136b-ps T A 15: 31,276,897 probably benign Het
Fdft1 C A 14: 63,163,404 K93N probably damaging Het
Gcc2 A G 10: 58,278,806 D959G probably damaging Het
Gm14085 T A 2: 122,522,914 probably null Het
Gm853 C T 4: 130,221,615 probably null Het
Gp2 A G 7: 119,454,291 V149A probably damaging Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Hdac9 A T 12: 34,373,907 C587S probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Iars2 A G 1: 185,317,928 V453A possibly damaging Het
Il1r1 T G 1: 40,293,524 C121W probably damaging Het
Jazf1 A G 6: 52,777,540 Y184H probably damaging Het
Kel A T 6: 41,699,055 Y234N probably damaging Het
Khk G A 5: 30,929,660 G186D probably damaging Het
Klf4 A T 4: 55,530,301 M270K probably benign Het
Kmt2c G A 5: 25,314,708 L2135F probably benign Het
Krtap15 A G 16: 88,829,156 Y37C probably damaging Het
Lars A G 18: 42,214,776 F994S possibly damaging Het
Lrp8 T C 4: 107,834,755 probably null Het
Lrrc2 A T 9: 110,980,919 D341V probably damaging Het
Map4k4 A G 1: 40,007,502 K646R probably damaging Het
Mrps9 T A 1: 42,895,331 probably null Het
Olfr1130 T A 2: 87,607,711 C108S probably damaging Het
Olfr745 T A 14: 50,643,162 Y288N probably damaging Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pcnt A T 10: 76,399,945 C1401S possibly damaging Het
Pdgfrb A T 18: 61,077,668 K749M probably damaging Het
Pigo A T 4: 43,019,412 W969R probably null Het
Pigr A T 1: 130,844,699 Y218F probably damaging Het
Pih1d1 A G 7: 45,154,854 probably benign Het
Pik3cg A T 12: 32,199,196 probably null Het
Pik3r6 A T 11: 68,533,468 K300* probably null Het
Pip5k1c A G 10: 81,305,250 D64G probably damaging Het
Piwil2 A T 14: 70,421,593 I161K possibly damaging Het
Pou3f1 A G 4: 124,658,656 E317G probably damaging Het
Prdm8 C T 5: 98,185,212 Q213* probably null Het
Prpf6 T A 2: 181,650,106 C739S possibly damaging Het
Psmc3 T A 2: 91,054,608 S40T probably benign Het
Psmd3 A T 11: 98,682,824 D32V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rapgef6 A T 11: 54,691,381 H1373L possibly damaging Het
Rnf207 A C 4: 152,313,209 S328A probably benign Het
Ros1 C T 10: 52,128,416 probably null Het
Ryr2 T A 13: 11,587,254 I4581F possibly damaging Het
Sacm1l C T 9: 123,586,399 R480W probably damaging Het
Sec16a A G 2: 26,419,649 V664A probably benign Het
Selenoo T A 15: 89,092,766 M207K probably damaging Het
Sh3tc2 G A 18: 62,014,891 probably null Het
Slco2b1 G T 7: 99,660,049 Q692K probably benign Het
Slfn4 A T 11: 83,186,797 D137V probably damaging Het
Srrm2 G A 17: 23,820,618 A2175T probably damaging Het
Stard9 T A 2: 120,693,399 C692S probably benign Het
Sulf2 T A 2: 166,081,622 D559V probably benign Het
Tbpl2 T C 2: 24,087,158 I283V probably benign Het
Tmem19 A G 10: 115,359,761 F46S probably benign Het
Ttn T A 2: 76,886,442 probably benign Het
Ube2z A T 11: 96,050,322 H331Q probably benign Het
Ubr1 C T 2: 120,911,997 probably null Het
Uhrf1bp1 A G 17: 27,886,864 E788G probably damaging Het
Vmn1r235 A T 17: 21,262,288 I292F possibly damaging Het
Vmn2r1 T A 3: 64,105,080 D787E probably damaging Het
Vmn2r3 A G 3: 64,259,799 V637A probably benign Het
Xpnpep1 C A 19: 53,006,175 V341L probably benign Het
Yme1l1 A G 2: 23,194,747 D619G probably damaging Het
Zfp597 G A 16: 3,866,638 P85S probably damaging Het
Zscan20 A G 4: 128,586,128 S857P probably benign Het
Other mutations in Trp63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00935:Trp63 APN 16 25871076 missense probably damaging 1.00
IGL01402:Trp63 APN 16 25820385 splice site probably benign
IGL01404:Trp63 APN 16 25820385 splice site probably benign
IGL01874:Trp63 APN 16 25882585 missense possibly damaging 0.88
IGL01887:Trp63 APN 16 25865319 missense probably damaging 1.00
IGL02008:Trp63 APN 16 25862461 missense probably damaging 1.00
IGL02336:Trp63 APN 16 25820442 missense probably damaging 1.00
IGL02470:Trp63 APN 16 25820384 splice site probably benign
IGL02720:Trp63 APN 16 25863741 missense probably damaging 0.96
IGL03230:Trp63 APN 16 25889010 missense probably damaging 1.00
PIT4142001:Trp63 UTSW 16 25865263 missense probably damaging 1.00
R0086:Trp63 UTSW 16 25871087 missense probably damaging 1.00
R0281:Trp63 UTSW 16 25764302 splice site probably benign
R1448:Trp63 UTSW 16 25889120 missense possibly damaging 0.67
R1517:Trp63 UTSW 16 25889253 missense probably damaging 1.00
R1539:Trp63 UTSW 16 25884849 missense probably benign 0.02
R3922:Trp63 UTSW 16 25889009 missense probably damaging 1.00
R3977:Trp63 UTSW 16 25820740 intron probably benign
R3978:Trp63 UTSW 16 25820740 intron probably benign
R3979:Trp63 UTSW 16 25820740 intron probably benign
R4689:Trp63 UTSW 16 25865262 missense possibly damaging 0.90
R4870:Trp63 UTSW 16 25866218 makesense probably null
R5009:Trp63 UTSW 16 25868227 missense probably damaging 0.99
R5058:Trp63 UTSW 16 25882594 missense probably damaging 1.00
R5118:Trp63 UTSW 16 25889010 missense unknown
R5354:Trp63 UTSW 16 25684355 splice site probably null
R5363:Trp63 UTSW 16 25863718 missense probably damaging 0.99
R5668:Trp63 UTSW 16 25866185 missense possibly damaging 0.52
R6004:Trp63 UTSW 16 25763396 critical splice donor site probably null
R6029:Trp63 UTSW 16 25868214 missense probably damaging 1.00
R6170:Trp63 UTSW 16 25884853 missense probably benign 0.28
R6186:Trp63 UTSW 16 25876733 intron probably benign
R6266:Trp63 UTSW 16 25862460 missense probably damaging 0.99
R6466:Trp63 UTSW 16 25763358 missense probably damaging 1.00
R6486:Trp63 UTSW 16 25865340 missense probably damaging 0.99
R6913:Trp63 UTSW 16 25889168 missense probably damaging 1.00
R6980:Trp63 UTSW 16 25802093 missense probably benign
R7097:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7122:Trp63 UTSW 16 25820477 missense probably damaging 1.00
R7544:Trp63 UTSW 16 25802087 missense probably benign
R7690:Trp63 UTSW 16 25876733 missense unknown
R7743:Trp63 UTSW 16 25882625 missense probably benign 0.05
R7766:Trp63 UTSW 16 25868219 missense probably damaging 0.97
R7792:Trp63 UTSW 16 25868224 missense possibly damaging 0.94
R7816:Trp63 UTSW 16 25889240 missense probably damaging 1.00
R7978:Trp63 UTSW 16 25820686 missense unknown
R8324:Trp63 UTSW 16 25876734 missense unknown
R8857:Trp63 UTSW 16 25820476 missense probably damaging 1.00
R9041:Trp63 UTSW 16 25763333 missense probably benign
R9123:Trp63 UTSW 16 25820497 missense probably damaging 1.00
R9491:Trp63 UTSW 16 25876722 missense unknown
Z1088:Trp63 UTSW 16 25763313 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGGGCAGATTGTAGCCCATG -3'
(R):5'- TGGGGAGGCATTTAGAATATCTAC -3'

Sequencing Primer
(F):5'- GCCCATGCTGCTTTCTAAAGAAAC -3'
(R):5'- TATGCTGGAAGACCTCTG -3'
Posted On 2016-06-06