Incidental Mutation 'R5033:Pdgfrb'
ID 389416
Institutional Source Beutler Lab
Gene Symbol Pdgfrb
Ensembl Gene ENSMUSG00000024620
Gene Name platelet derived growth factor receptor, beta polypeptide
Synonyms CD140b, Pdgfr
MMRRC Submission 042624-MU
Accession Numbers

Ncbi RefSeq: NM_001146268.1, NM_008809.2; MGI:97531
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5033 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 61045150-61085061 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 61077668 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Methionine at position 749 (K749M)
Ref Sequence ENSEMBL: ENSMUSP00000110929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000025522
AA Change: K745M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620
AA Change: K745M

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
IG 38 120 5.58e-2 SMART
IGc2 225 297 2.83e-12 SMART
IG_like 330 402 1.47e0 SMART
Pfam:Ig_2 415 524 5.6e-2 PFAM
transmembrane domain 534 556 N/A INTRINSIC
TyrKc 600 958 1.11e-135 SMART
low complexity region 1063 1083 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115274
AA Change: K749M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620
AA Change: K749M

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 42 124 5.58e-2 SMART
IGc2 229 301 2.83e-12 SMART
IG_like 334 406 1.47e0 SMART
transmembrane domain 538 560 N/A INTRINSIC
TyrKc 604 962 1.11e-135 SMART
low complexity region 1067 1087 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype Strain: 2682393; 2135508
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A G 9: 103,279,414 V149A probably benign Het
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
4931406P16Rik C T 7: 34,245,812 G336S probably benign Het
9930111J21Rik1 G A 11: 48,947,706 R685W probably damaging Het
Arhgap10 A T 8: 77,382,757 L399H probably damaging Het
Arih2 AGCCG AG 9: 108,611,660 probably benign Het
Atp13a2 A G 4: 141,000,821 H575R possibly damaging Het
Bbof1 G A 12: 84,411,270 probably null Het
Catsperg2 A C 7: 29,710,134 Y545D possibly damaging Het
Cdc42bpa T A 1: 180,065,015 I248N probably damaging Het
Cdk11b A T 4: 155,648,825 probably benign Het
Cfap46 C A 7: 139,603,860 L90F probably benign Het
Cndp2 A G 18: 84,670,829 L276P possibly damaging Het
Col3a1 A C 1: 45,346,110 D129A probably damaging Het
Daam1 C A 12: 71,946,520 H354Q unknown Het
Dnah5 T A 15: 28,421,678 F3892Y probably damaging Het
Dnajb3 A G 1: 88,205,023 V219A possibly damaging Het
Drd5 A G 5: 38,320,201 H179R probably damaging Het
Dym A G 18: 75,119,161 N333D possibly damaging Het
Eif2b3 A G 4: 117,052,736 D156G probably damaging Het
Emc1 A G 4: 139,371,696 D830G probably damaging Het
F13a1 A C 13: 36,988,856 I183M probably damaging Het
Fam136b-ps T A 15: 31,276,897 probably benign Het
Fdft1 C A 14: 63,163,404 K93N probably damaging Het
Gcc2 A G 10: 58,278,806 D959G probably damaging Het
Gm14085 T A 2: 122,522,914 probably null Het
Gm853 C T 4: 130,221,615 probably null Het
Gp2 A G 7: 119,454,291 V149A probably damaging Het
Gpc1 G A 1: 92,857,029 G308D probably damaging Het
Hdac9 A T 12: 34,373,907 C587S probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Iars2 A G 1: 185,317,928 V453A possibly damaging Het
Il1r1 T G 1: 40,293,524 C121W probably damaging Het
Jazf1 A G 6: 52,777,540 Y184H probably damaging Het
Kel A T 6: 41,699,055 Y234N probably damaging Het
Khk G A 5: 30,929,660 G186D probably damaging Het
Klf4 A T 4: 55,530,301 M270K probably benign Het
Kmt2c G A 5: 25,314,708 L2135F probably benign Het
Krtap15 A G 16: 88,829,156 Y37C probably damaging Het
Lars A G 18: 42,214,776 F994S possibly damaging Het
Lrp8 T C 4: 107,834,755 probably null Het
Lrrc2 A T 9: 110,980,919 D341V probably damaging Het
Map4k4 A G 1: 40,007,502 K646R probably damaging Het
Mrps9 T A 1: 42,895,331 probably null Het
Olfr1130 T A 2: 87,607,711 C108S probably damaging Het
Olfr745 T A 14: 50,643,162 Y288N probably damaging Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pcnt A T 10: 76,399,945 C1401S possibly damaging Het
Pigo A T 4: 43,019,412 W969R probably null Het
Pigr A T 1: 130,844,699 Y218F probably damaging Het
Pih1d1 A G 7: 45,154,854 probably benign Het
Pik3cg A T 12: 32,199,196 probably null Het
Pik3r6 A T 11: 68,533,468 K300* probably null Het
Pip5k1c A G 10: 81,305,250 D64G probably damaging Het
Piwil2 A T 14: 70,421,593 I161K possibly damaging Het
Pou3f1 A G 4: 124,658,656 E317G probably damaging Het
Prdm8 C T 5: 98,185,212 Q213* probably null Het
Prpf6 T A 2: 181,650,106 C739S possibly damaging Het
Psmc3 T A 2: 91,054,608 S40T probably benign Het
Psmd3 A T 11: 98,682,824 D32V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rapgef6 A T 11: 54,691,381 H1373L possibly damaging Het
Rnf207 A C 4: 152,313,209 S328A probably benign Het
Ros1 C T 10: 52,128,416 probably null Het
Ryr2 T A 13: 11,587,254 I4581F possibly damaging Het
Sacm1l C T 9: 123,586,399 R480W probably damaging Het
Sec16a A G 2: 26,419,649 V664A probably benign Het
Selenoo T A 15: 89,092,766 M207K probably damaging Het
Sh3tc2 G A 18: 62,014,891 probably null Het
Slco2b1 G T 7: 99,660,049 Q692K probably benign Het
Slfn4 A T 11: 83,186,797 D137V probably damaging Het
Srrm2 G A 17: 23,820,618 A2175T probably damaging Het
Stard9 T A 2: 120,693,399 C692S probably benign Het
Sulf2 T A 2: 166,081,622 D559V probably benign Het
Tbpl2 T C 2: 24,087,158 I283V probably benign Het
Tmem19 A G 10: 115,359,761 F46S probably benign Het
Trp63 T A 16: 25,763,306 Y35N probably damaging Het
Ttn T A 2: 76,886,442 probably benign Het
Ube2z A T 11: 96,050,322 H331Q probably benign Het
Ubr1 C T 2: 120,911,997 probably null Het
Uhrf1bp1 A G 17: 27,886,864 E788G probably damaging Het
Vmn1r235 A T 17: 21,262,288 I292F possibly damaging Het
Vmn2r1 T A 3: 64,105,080 D787E probably damaging Het
Vmn2r3 A G 3: 64,259,799 V637A probably benign Het
Xpnpep1 C A 19: 53,006,175 V341L probably benign Het
Yme1l1 A G 2: 23,194,747 D619G probably damaging Het
Zfp597 G A 16: 3,866,638 P85S probably damaging Het
Zscan20 A G 4: 128,586,128 S857P probably benign Het
Other mutations in Pdgfrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Pdgfrb APN 18 61068936 missense probably benign 0.20
IGL01396:Pdgfrb APN 18 61072664 missense probably damaging 1.00
IGL02377:Pdgfrb APN 18 61080332 missense probably damaging 1.00
IGL02435:Pdgfrb APN 18 61064926 critical splice donor site probably null
IGL03397:Pdgfrb APN 18 61079681 missense probably benign 0.28
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0087:Pdgfrb UTSW 18 61061513 missense probably damaging 1.00
R0119:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0299:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0532:Pdgfrb UTSW 18 61083265 missense probably damaging 1.00
R0570:Pdgfrb UTSW 18 61077703 missense probably benign 0.00
R0629:Pdgfrb UTSW 18 61078648 critical splice donor site probably null
R0650:Pdgfrb UTSW 18 61079708 missense probably benign 0.00
R0853:Pdgfrb UTSW 18 61080327 missense probably damaging 1.00
R1165:Pdgfrb UTSW 18 61064002 missense probably benign 0.01
R1342:Pdgfrb UTSW 18 61065880 nonsense probably null
R1740:Pdgfrb UTSW 18 61081833 missense possibly damaging 0.93
R1808:Pdgfrb UTSW 18 61068102 missense probably benign
R1864:Pdgfrb UTSW 18 61071717 missense probably benign 0.00
R1960:Pdgfrb UTSW 18 61065783 missense probably benign 0.05
R1961:Pdgfrb UTSW 18 61061505 missense possibly damaging 0.49
R1970:Pdgfrb UTSW 18 61066494 splice site probably benign
R2011:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2012:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2018:Pdgfrb UTSW 18 61083334 missense possibly damaging 0.84
R2153:Pdgfrb UTSW 18 61072756 missense probably damaging 1.00
R2497:Pdgfrb UTSW 18 61078628 missense possibly damaging 0.58
R2846:Pdgfrb UTSW 18 61064016 missense probably benign 0.00
R3776:Pdgfrb UTSW 18 61081920 missense probably benign 0.00
R3779:Pdgfrb UTSW 18 61072666 missense probably damaging 1.00
R3816:Pdgfrb UTSW 18 61078945 missense probably damaging 1.00
R3978:Pdgfrb UTSW 18 61073685 missense probably damaging 1.00
R4259:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4261:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4327:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4329:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4598:Pdgfrb UTSW 18 61068757 missense probably benign 0.03
R4668:Pdgfrb UTSW 18 61064113 missense probably damaging 1.00
R4761:Pdgfrb UTSW 18 61079700 missense probably damaging 1.00
R4787:Pdgfrb UTSW 18 61079687 missense probably damaging 1.00
R4828:Pdgfrb UTSW 18 61073243 missense probably damaging 0.98
R5030:Pdgfrb UTSW 18 61065135 missense probably benign 0.13
R5447:Pdgfrb UTSW 18 61068108 missense probably damaging 1.00
R6224:Pdgfrb UTSW 18 61081939 nonsense probably null
R6807:Pdgfrb UTSW 18 61078649 critical splice donor site probably null
R6858:Pdgfrb UTSW 18 61065147 missense probably benign 0.01
R7017:Pdgfrb UTSW 18 61081004 missense probably benign 0.00
R7089:Pdgfrb UTSW 18 61073243 missense probably damaging 1.00
R7174:Pdgfrb UTSW 18 61066515 missense probably benign
R7374:Pdgfrb UTSW 18 61071708 missense possibly damaging 0.64
R7496:Pdgfrb UTSW 18 61078932 missense possibly damaging 0.71
R7565:Pdgfrb UTSW 18 61083264 missense probably damaging 1.00
R7615:Pdgfrb UTSW 18 61064046 missense probably benign 0.00
R7691:Pdgfrb UTSW 18 61061268 missense probably benign 0.05
R7884:Pdgfrb UTSW 18 61072658 missense probably damaging 1.00
R8481:Pdgfrb UTSW 18 61065742 missense probably benign 0.03
R8735:Pdgfrb UTSW 18 61063977 missense probably benign 0.26
R8737:Pdgfrb UTSW 18 61081001 missense probably damaging 1.00
R9067:Pdgfrb UTSW 18 61068219 missense probably null 0.93
R9106:Pdgfrb UTSW 18 61046028 critical splice acceptor site probably null
R9161:Pdgfrb UTSW 18 61063981 missense probably damaging 1.00
R9234:Pdgfrb UTSW 18 61061228 missense probably null 0.00
R9380:Pdgfrb UTSW 18 61064848 missense probably damaging 1.00
R9452:Pdgfrb UTSW 18 61065726 missense possibly damaging 0.77
R9491:Pdgfrb UTSW 18 61078984 missense probably damaging 1.00
X0060:Pdgfrb UTSW 18 61081976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCACACAGGTTAGTTGAAGG -3'
(R):5'- AAGACATTGCTGTGCGTATTG -3'

Sequencing Primer
(F):5'- CAGTCATTCACACTGTATGGTGAC -3'
(R):5'- CTGTGCGTATTGGATGAGCC -3'
Posted On 2016-06-06