Mutagenetix > Incidental Mutation

Incidental Mutation 'R5033:Dym'

389418

Institutional Source

Beutler Lab

Gene Symbol

Dym

Ensembl Gene

ENSMUSG00000035765

Gene Name

dymeclin

Synonyms

C030019K18Rik, 4933427L07Rik, 1810041M12Rik

MMRRC Submission

042624-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5033 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75018772-75286966 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75119161 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 333 (N333D)

Ref Sequence

ENSEMBL: ENSMUSP00000047054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039608]

AlphaFold

Q8CHY3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039608
AA Change: N333D

PolyPhen 2 Score 0.779 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000047054
Gene: ENSMUSG00000035765
AA Change: N333D

Domain	Start	End	E-Value	Type
Pfam:Dymeclin	1	646	3.3e-174	PFAM
Pfam:Hid1	309	584	3e-11	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is necessary for normal skeletal development and brain function. Mutations in this gene are associated with two types of recessive osteochondrodysplasia, Dyggve-Melchior-Clausen (DMC) dysplasia and Smith-McCort (SMC) dysplasia, which involve both skeletal defects and mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele display decreased body size with short tubular bones, chondrodysplasia, partial penetrance of obstructive hydronephrosis and impaired vesicular transport. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	G	9: 103,279,414	V149A	probably benign	Het
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
4931406P16Rik	C	T	7: 34,245,812	G336S	probably benign	Het
9930111J21Rik1	G	A	11: 48,947,706	R685W	probably damaging	Het
Arhgap10	A	T	8: 77,382,757	L399H	probably damaging	Het
Arih2	AGCCG	AG	9: 108,611,660		probably benign	Het
Atp13a2	A	G	4: 141,000,821	H575R	possibly damaging	Het
Bbof1	G	A	12: 84,411,270		probably null	Het
Catsperg2	A	C	7: 29,710,134	Y545D	possibly damaging	Het
Cdc42bpa	T	A	1: 180,065,015	I248N	probably damaging	Het
Cdk11b	A	T	4: 155,648,825		probably benign	Het
Cfap46	C	A	7: 139,603,860	L90F	probably benign	Het
Cndp2	A	G	18: 84,670,829	L276P	possibly damaging	Het
Col3a1	A	C	1: 45,346,110	D129A	probably damaging	Het
Daam1	C	A	12: 71,946,520	H354Q	unknown	Het
Dnah5	T	A	15: 28,421,678	F3892Y	probably damaging	Het
Dnajb3	A	G	1: 88,205,023	V219A	possibly damaging	Het
Drd5	A	G	5: 38,320,201	H179R	probably damaging	Het
Eif2b3	A	G	4: 117,052,736	D156G	probably damaging	Het
Emc1	A	G	4: 139,371,696	D830G	probably damaging	Het
F13a1	A	C	13: 36,988,856	I183M	probably damaging	Het
Fam136b-ps	T	A	15: 31,276,897		probably benign	Het
Fdft1	C	A	14: 63,163,404	K93N	probably damaging	Het
Gcc2	A	G	10: 58,278,806	D959G	probably damaging	Het
Gm14085	T	A	2: 122,522,914		probably null	Het
Gm853	C	T	4: 130,221,615		probably null	Het
Gp2	A	G	7: 119,454,291	V149A	probably damaging	Het
Gpc1	G	A	1: 92,857,029	G308D	probably damaging	Het
Hdac9	A	T	12: 34,373,907	C587S	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Iars2	A	G	1: 185,317,928	V453A	possibly damaging	Het
Il1r1	T	G	1: 40,293,524	C121W	probably damaging	Het
Jazf1	A	G	6: 52,777,540	Y184H	probably damaging	Het
Kel	A	T	6: 41,699,055	Y234N	probably damaging	Het
Khk	G	A	5: 30,929,660	G186D	probably damaging	Het
Klf4	A	T	4: 55,530,301	M270K	probably benign	Het
Kmt2c	G	A	5: 25,314,708	L2135F	probably benign	Het
Krtap15	A	G	16: 88,829,156	Y37C	probably damaging	Het
Lars	A	G	18: 42,214,776	F994S	possibly damaging	Het
Lrp8	T	C	4: 107,834,755		probably null	Het
Lrrc2	A	T	9: 110,980,919	D341V	probably damaging	Het
Map4k4	A	G	1: 40,007,502	K646R	probably damaging	Het
Mrps9	T	A	1: 42,895,331		probably null	Het
Olfr1130	T	A	2: 87,607,711	C108S	probably damaging	Het
Olfr745	T	A	14: 50,643,162	Y288N	probably damaging	Het
Olfr898	C	T	9: 38,349,628	H176Y	probably damaging	Het
Pcnt	A	T	10: 76,399,945	C1401S	possibly damaging	Het
Pdgfrb	A	T	18: 61,077,668	K749M	probably damaging	Het
Pigo	A	T	4: 43,019,412	W969R	probably null	Het
Pigr	A	T	1: 130,844,699	Y218F	probably damaging	Het
Pih1d1	A	G	7: 45,154,854		probably benign	Het
Pik3cg	A	T	12: 32,199,196		probably null	Het
Pik3r6	A	T	11: 68,533,468	K300*	probably null	Het
Pip5k1c	A	G	10: 81,305,250	D64G	probably damaging	Het
Piwil2	A	T	14: 70,421,593	I161K	possibly damaging	Het
Pou3f1	A	G	4: 124,658,656	E317G	probably damaging	Het
Prdm8	C	T	5: 98,185,212	Q213*	probably null	Het
Prpf6	T	A	2: 181,650,106	C739S	possibly damaging	Het
Psmc3	T	A	2: 91,054,608	S40T	probably benign	Het
Psmd3	A	T	11: 98,682,824	D32V	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rapgef6	A	T	11: 54,691,381	H1373L	possibly damaging	Het
Rnf207	A	C	4: 152,313,209	S328A	probably benign	Het
Ros1	C	T	10: 52,128,416		probably null	Het
Ryr2	T	A	13: 11,587,254	I4581F	possibly damaging	Het
Sacm1l	C	T	9: 123,586,399	R480W	probably damaging	Het
Sec16a	A	G	2: 26,419,649	V664A	probably benign	Het
Selenoo	T	A	15: 89,092,766	M207K	probably damaging	Het
Sh3tc2	G	A	18: 62,014,891		probably null	Het
Slco2b1	G	T	7: 99,660,049	Q692K	probably benign	Het
Slfn4	A	T	11: 83,186,797	D137V	probably damaging	Het
Srrm2	G	A	17: 23,820,618	A2175T	probably damaging	Het
Stard9	T	A	2: 120,693,399	C692S	probably benign	Het
Sulf2	T	A	2: 166,081,622	D559V	probably benign	Het
Tbpl2	T	C	2: 24,087,158	I283V	probably benign	Het
Tmem19	A	G	10: 115,359,761	F46S	probably benign	Het
Trp63	T	A	16: 25,763,306	Y35N	probably damaging	Het
Ttn	T	A	2: 76,886,442		probably benign	Het
Ube2z	A	T	11: 96,050,322	H331Q	probably benign	Het
Ubr1	C	T	2: 120,911,997		probably null	Het
Uhrf1bp1	A	G	17: 27,886,864	E788G	probably damaging	Het
Vmn1r235	A	T	17: 21,262,288	I292F	possibly damaging	Het
Vmn2r1	T	A	3: 64,105,080	D787E	probably damaging	Het
Vmn2r3	A	G	3: 64,259,799	V637A	probably benign	Het
Xpnpep1	C	A	19: 53,006,175	V341L	probably benign	Het
Yme1l1	A	G	2: 23,194,747	D619G	probably damaging	Het
Zfp597	G	A	16: 3,866,638	P85S	probably damaging	Het
Zscan20	A	G	4: 128,586,128	S857P	probably benign	Het

Other mutations in Dym

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Dym	APN	18	75119249	missense	probably benign	0.43
IGL01593:Dym	APN	18	75114781	splice site	probably benign
IGL02657:Dym	APN	18	75082456	nonsense	probably null
IGL02716:Dym	APN	18	75286683	missense	probably damaging	1.00
IGL02977:Dym	APN	18	75063175	critical splice donor site	probably null
asesino	UTSW	18	75056641	missense	probably damaging	1.00
flavor	UTSW	18	75056738	nonsense	probably null
geschmack	UTSW	18	75063174	critical splice donor site	probably null
kugel	UTSW	18	75056738	nonsense	probably null
sabor	UTSW	18	75125539	critical splice donor site	probably null
R0042:Dym	UTSW	18	75125539	critical splice donor site	probably null
R0058:Dym	UTSW	18	75043172	missense	possibly damaging	0.94
R0058:Dym	UTSW	18	75043172	missense	possibly damaging	0.94
R0320:Dym	UTSW	18	75199262	missense	probably damaging	0.99
R0943:Dym	UTSW	18	75286769	makesense	probably null
R1677:Dym	UTSW	18	75125512	missense	probably damaging	1.00
R2022:Dym	UTSW	18	75080250	missense	probably benign	0.05
R2221:Dym	UTSW	18	75230165	missense	probably damaging	1.00
R2292:Dym	UTSW	18	75199212	missense	possibly damaging	0.95
R4087:Dym	UTSW	18	75230101	missense	probably damaging	1.00
R4929:Dym	UTSW	18	75243286	missense	probably damaging	1.00
R6489:Dym	UTSW	18	75080226	missense	probably benign	0.27
R6641:Dym	UTSW	18	75056641	missense	probably damaging	1.00
R6751:Dym	UTSW	18	75286647	missense	probably damaging	0.98
R6864:Dym	UTSW	18	75056738	nonsense	probably null
R7284:Dym	UTSW	18	75119171	missense	possibly damaging	0.60
R7319:Dym	UTSW	18	75063174	critical splice donor site	probably null
R8095:Dym	UTSW	18	75114801	missense	possibly damaging	0.75
R8683:Dym	UTSW	18	75230018	missense	probably damaging	1.00
R8686:Dym	UTSW	18	75286683	missense	probably damaging	1.00
R8713:Dym	UTSW	18	75056738	nonsense	probably null
R9022:Dym	UTSW	18	75125436	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGGATCAATAGTTGTAGTCAGTGC -3'
(R):5'- TGAGCACTCTGAGCCTCTTG -3'

Sequencing Primer
(F):5'- CAATAGTTGTAGTCAGTGCTTCAG -3'
(R):5'- ACTCTGAGCCTCTTGGGAAAG -3'

Posted On

2016-06-06