Incidental Mutation 'R5034:Lin9'
ID389422
Institutional Source Beutler Lab
Gene Symbol Lin9
Ensembl Gene ENSMUSG00000058729
Gene Namelin-9 homolog (C. elegans)
Synonyms2700022J23Rik
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180641150-180690694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180669198 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 351 (L351I)
Ref Sequence ENSEMBL: ENSMUSP00000141331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]
Predicted Effect probably benign
Transcript: ENSMUST00000085803
AA Change: L335I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000082959
Gene: ENSMUSG00000058729
AA Change: L335I

DomainStartEndE-ValueType
DIRP 127 232 2.93e-67 SMART
coiled coil region 354 412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085804
SMART Domains Protein: ENSMUSP00000082960
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.93e-67 SMART
coiled coil region 354 412 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
low complexity region 445 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191744
Predicted Effect probably benign
Transcript: ENSMUST00000192561
AA Change: L351I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729
AA Change: L351I

DomainStartEndE-ValueType
DIRP 143 248 2.2e-71 SMART
coiled coil region 370 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192725
AA Change: L311I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729
AA Change: L311I

DomainStartEndE-ValueType
DIRP 103 208 2.2e-71 SMART
coiled coil region 330 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193892
SMART Domains Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.2e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194638
Meta Mutation Damage Score 0.0673 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that inhibits DNA synthesis and oncogenic transformation through association with the retinoblastoma 1 protein. The encoded protein also interacts with a complex of other cell cycle regulators to repress cell cycle-dependent gene expression in non-dividing cells. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show increased body weight. Mice homozygous for a gene-trap allele die shortly after implantation with defects in early embryogenesis. Homozygous deletion in adult mice causes premature death, intestinal epithelium atrophy, and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Lin9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02220:Lin9 APN 1 180667367 missense probably damaging 1.00
IGL02221:Lin9 APN 1 180650834 missense probably benign 0.03
IGL02233:Lin9 APN 1 180689300 missense probably damaging 0.98
IGL02370:Lin9 APN 1 180688018 missense probably damaging 1.00
IGL02794:Lin9 APN 1 180651879 missense probably damaging 1.00
R0278:Lin9 UTSW 1 180665923 missense probably damaging 1.00
R1488:Lin9 UTSW 1 180688285 missense possibly damaging 0.61
R3808:Lin9 UTSW 1 180659111 missense probably null 0.32
R3809:Lin9 UTSW 1 180659111 missense probably null 0.32
R3884:Lin9 UTSW 1 180688065 nonsense probably null
R3978:Lin9 UTSW 1 180668792 missense possibly damaging 0.94
R4600:Lin9 UTSW 1 180681194 missense probably damaging 0.99
R4625:Lin9 UTSW 1 180689280 missense probably damaging 0.99
R4730:Lin9 UTSW 1 180665851 nonsense probably null
R4987:Lin9 UTSW 1 180668764 missense probably damaging 1.00
R5035:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5045:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5046:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5148:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5180:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5181:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5221:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5222:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5329:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5332:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5633:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5634:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5696:Lin9 UTSW 1 180659081 missense probably benign 0.00
R5812:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5813:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5814:Lin9 UTSW 1 180669198 missense probably benign 0.01
R5851:Lin9 UTSW 1 180669198 missense probably benign 0.01
R7046:Lin9 UTSW 1 180667370 missense probably damaging 1.00
R7084:Lin9 UTSW 1 180688096 missense probably benign 0.11
Z1177:Lin9 UTSW 1 180650802 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GCTACTTCAGGACTTGAGCTACC -3'
(R):5'- TGGAAATAGCAGAGTCCTGAAAACC -3'

Sequencing Primer
(F):5'- CAGGACTTGAGCTACCAATATTATG -3'
(R):5'- GAGTCCTGAAAACCCACATAGTG -3'
Posted On2016-06-06