Incidental Mutation 'R5034:Olfr1026'
ID389423
Institutional Source Beutler Lab
Gene Symbol Olfr1026
Ensembl Gene ENSMUSG00000042863
Gene Nameolfactory receptor 1026
SynonymsGA_x6K02T2Q125-47402610-47403533, MOR196-4
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85921558-85924623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85923547 bp
ZygosityHeterozygous
Amino Acid Change Serine to Tyrosine at position 93 (S93Y)
Ref Sequence ENSEMBL: ENSMUSP00000151927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056718] [ENSMUST00000188749] [ENSMUST00000213474] [ENSMUST00000217615] [ENSMUST00000219615]
Predicted Effect probably damaging
Transcript: ENSMUST00000056718
AA Change: S93Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049887
Gene: ENSMUSG00000042863
AA Change: S93Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.1e-58 PFAM
Pfam:7tm_1 41 290 9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188749
SMART Domains Protein: ENSMUSP00000139860
Gene: ENSMUSG00000058884

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 7.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213474
Predicted Effect probably damaging
Transcript: ENSMUST00000217615
AA Change: S93Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000219615
AA Change: S93Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Olfr1026
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01701:Olfr1026 APN 2 85924077 missense possibly damaging 0.81
PIT4151001:Olfr1026 UTSW 2 85924042 missense probably damaging 1.00
R0147:Olfr1026 UTSW 2 85924018 missense possibly damaging 0.61
R0601:Olfr1026 UTSW 2 85923378 missense probably benign 0.01
R0899:Olfr1026 UTSW 2 85923387 missense probably benign
R1728:Olfr1026 UTSW 2 85924122 missense possibly damaging 0.48
R2004:Olfr1026 UTSW 2 85923595 unclassified probably null
R2020:Olfr1026 UTSW 2 85923743 missense probably benign
R2396:Olfr1026 UTSW 2 85923925 missense probably benign 0.00
R2519:Olfr1026 UTSW 2 85923607 missense probably damaging 1.00
R3153:Olfr1026 UTSW 2 85923730 missense probably benign
R4696:Olfr1026 UTSW 2 85918871 unclassified probably null
R5221:Olfr1026 UTSW 2 85924149 missense probably damaging 1.00
R5334:Olfr1026 UTSW 2 85923714 missense probably damaging 1.00
R6041:Olfr1026 UTSW 2 85923391 missense probably damaging 1.00
R7602:Olfr1026 UTSW 2 85923802 missense probably damaging 1.00
Z1088:Olfr1026 UTSW 2 85923798 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGACTGGTAACGTGAG -3'
(R):5'- ATTGGGTCCACAAAAGGTTAAACG -3'

Sequencing Primer
(F):5'- ACTGGTAACGTGAGCATGATCTTC -3'
(R):5'- CAAAGCCGTAAATGTACTGTGTG -3'
Posted On2016-06-06