Mutagenetix > Incidental Mutation

Incidental Mutation 'R0433:Dnah2'

38943

Institutional Source

Beutler Lab

Gene Symbol

Dnah2

Ensembl Gene

ENSMUSG00000005237

Gene Name

dynein, axonemal, heavy chain 2

Synonyms

Dnahc2, Dnhd3, D330014H01Rik, 2900022L05Rik

MMRRC Submission

038635-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0433 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69420809-69549110 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 69459288 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 2340 (D2340Y)

Ref Sequence

ENSEMBL: ENSMUSP00000104299 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035539] [ENSMUST00000108659]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035539
AA Change: D2334Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047329
Gene: ENSMUSG00000005237
AA Change: D2334Y

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
Pfam:DHC_N1	273	429	6.6e-37	PFAM
Pfam:DHC_N1	432	761	1.3e-54	PFAM
Pfam:DHC_N2	1253	1668	3.4e-144	PFAM
AAA	1826	1962	2.95e-1	SMART
Pfam:AAA_5	2108	2251	1.3e-5	PFAM
AAA	2437	2584	3.63e-5	SMART
Pfam:AAA_8	2752	3022	1.1e-75	PFAM
Pfam:MT	3034	3370	8.7e-55	PFAM
Pfam:AAA_9	3386	3616	7.4e-68	PFAM
Pfam:Dynein_heavy	3748	4453	1.2e-220	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108659
AA Change: D2340Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000104299
Gene: ENSMUSG00000005237
AA Change: D2340Y

Domain	Start	End	E-Value	Type
low complexity region	4	25	N/A	INTRINSIC
Pfam:DHC_N1	274	429	1.1e-47	PFAM
Pfam:DHC_N1	438	760	1.5e-75	PFAM
Pfam:DHC_N2	1255	1666	4.4e-144	PFAM
low complexity region	1711	1720	N/A	INTRINSIC
AAA	1832	1968	2.95e-1	SMART
Blast:AAA	2111	2251	2e-86	BLAST
AAA	2443	2590	3.63e-5	SMART
Pfam:AAA_8	2758	3028	5.5e-77	PFAM
Pfam:MT	3040	3376	7.6e-55	PFAM
Pfam:AAA_9	3396	3621	7.5e-94	PFAM
Pfam:Dynein_heavy	3759	4458	4.9e-264	PFAM

Meta Mutation Damage Score

0.1634

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 94.3%

Validation Efficiency

99% (108/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH2 is an axonemal inner arm dynein heavy chain (Chapelin et al., 1997 [PubMed 9256245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 102 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032F04Rik	T	C	3: 68,870,303	V199A	possibly damaging	Het
2410089E03Rik	T	C	15: 8,216,562	S1473P	probably benign	Het
Abcb5	T	C	12: 118,877,810	M967V	probably benign	Het
Adcy10	T	A	1: 165,552,022	L951Q	probably damaging	Het
Amer2	A	T	14: 60,378,583	S76C	probably damaging	Het
Atad1	T	C	19: 32,698,477	I182M	probably benign	Het
Bpi	A	G	2: 158,258,419	D42G	probably damaging	Het
C7	G	T	15: 4,988,916	T815K	probably damaging	Het
Cacna1g	T	A	11: 94,459,207	D604V	probably benign	Het
Camk1g	A	G	1: 193,354,058	F165L	probably damaging	Het
Ccdc69	C	T	11: 55,052,890		probably null	Het
Ccser2	A	C	14: 36,918,529	F37L	probably damaging	Het
Cfap43	A	G	19: 47,825,771	F208S	probably benign	Het
Cfap54	G	A	10: 92,979,080		probably benign	Het
Cfap69	A	C	5: 5,649,853	D62E	probably damaging	Het
Cnksr2	C	A	X: 157,888,557	M483I	probably benign	Het
Cnksr2	A	T	X: 157,888,558	M483K	probably benign	Het
Cog8	T	C	8: 107,056,478	S60G	possibly damaging	Het
Col4a3	C	T	1: 82,670,219	P484S	unknown	Het
Col6a4	C	T	9: 106,067,994	G974R	probably damaging	Het
Dbnl	T	G	11: 5,796,825		probably null	Het
Dhcr7	T	C	7: 143,840,463	C114R	possibly damaging	Het
Dusp10	T	A	1: 184,069,196	Y387N	probably damaging	Het
Eipr1	C	T	12: 28,859,331	T199I	possibly damaging	Het
Emc2	T	G	15: 43,497,124		probably null	Het
Enpp3	A	G	10: 24,820,597	S147P	probably benign	Het
Fam133b	T	A	5: 3,558,560		probably benign	Het
Fam205c	A	G	4: 42,874,013		probably benign	Het
Fat1	C	A	8: 45,024,649	T2244K	possibly damaging	Het
Fbn1	A	G	2: 125,348,215	S1453P	possibly damaging	Het
Fez2	A	T	17: 78,418,047	F13I	probably damaging	Het
Ggnbp2	T	C	11: 84,836,420	K530R	probably damaging	Het
Gm597	A	T	1: 28,777,342	Y536*	probably null	Het
Gpa33	T	C	1: 166,163,761		probably benign	Het
Gpr142	T	C	11: 114,805,997	I123T	probably damaging	Het
Il21	T	G	3: 37,232,535	I11L	possibly damaging	Het
Klhl7	A	G	5: 24,127,702	E86G	probably damaging	Het
Klk10	G	T	7: 43,781,565	A11S	possibly damaging	Het
Knl1	A	T	2: 119,104,061	D2115V	probably damaging	Het
Lonp2	A	G	8: 86,633,954	D185G	probably damaging	Het
Lrrc47	T	C	4: 154,018,365		probably benign	Het
Lrrcc1	A	G	3: 14,559,374	I698V	probably damaging	Het
Lzts2	T	C	19: 45,021,676	V83A	possibly damaging	Het
Melk	C	A	4: 44,340,614		probably benign	Het
Mical1	G	A	10: 41,479,490	V150I	probably benign	Het
Morn3	C	A	5: 123,039,333	M129I	probably benign	Het
Mroh2b	T	A	15: 4,941,634	D1040E	probably benign	Het
Mroh5	T	C	15: 73,790,028	N438S	probably benign	Het
Mroh5	T	A	15: 73,790,808	Q387L	probably damaging	Het
Myh15	A	G	16: 49,145,236	D1168G	probably damaging	Het
Nek10	A	G	14: 14,860,927	E493G	probably benign	Het
Nipsnap3a	A	G	4: 53,000,316	Y227C	probably damaging	Het
Nlrp9c	T	A	7: 26,385,819	T112S	probably benign	Het
Nphp4	T	C	4: 152,518,172	V401A	probably benign	Het
Nr1h2	A	G	7: 44,549,987	*365Q	probably null	Het
Olfr1339	T	C	4: 118,735,090	V187A	probably benign	Het
Olfr474	T	C	7: 107,955,262	I207T	probably damaging	Het
Pacs2	T	A	12: 113,056,844	V279D	possibly damaging	Het
Pdcd2	C	T	17: 15,526,384	C171Y	probably benign	Het
Pde11a	T	A	2: 76,337,706	D301V	possibly damaging	Het
Pfpl	T	G	19: 12,429,475	N363K	probably damaging	Het
Phf14	T	A	6: 11,933,743	S201R	probably damaging	Het
Pip4k2c	G	A	10: 127,208,946	P66S	probably benign	Het
Pou2f3	G	T	9: 43,127,398	H392N	probably benign	Het
Pou3f1	G	T	4: 124,658,904	G400C	probably damaging	Het
Ptprg	T	C	14: 12,220,620	I1219T	probably damaging	Het
Rfx6	A	G	10: 51,720,028	D435G	probably damaging	Het
Rhpn2	T	A	7: 35,385,474	S598T	probably benign	Het
Sdccag8	C	A	1: 176,844,821		probably null	Het
Sec16b	C	A	1: 157,534,709	Y43*	probably null	Het
Sele	T	C	1: 164,049,244	Y30H	possibly damaging	Het
Sgsm2	C	T	11: 74,858,190		probably null	Het
Slc45a2	T	C	15: 11,025,745	Y394H	probably benign	Het
Slc4a10	T	G	2: 62,289,983	I788S	probably benign	Het
Slmap	A	T	14: 26,453,594	L161*	probably null	Het
Slx4	A	T	16: 3,986,018	D977E	probably benign	Het
Spen	A	T	4: 141,483,758	M608K	unknown	Het
St8sia4	G	C	1: 95,591,704	T353R	probably damaging	Het
Stab2	G	T	10: 86,843,491		probably benign	Het
Stx12	C	T	4: 132,858,430	G213D	probably damaging	Het
Synj2	A	T	17: 6,033,848	N270Y	probably damaging	Het
Tdrd9	C	T	12: 112,025,581	R438*	probably null	Het
Tert	T	C	13: 73,627,081	Y18H	probably damaging	Het
Tph1	A	T	7: 46,653,821	F244L	probably damaging	Het
Triobp	T	C	15: 78,968,201	F852L	possibly damaging	Het
Trpv1	T	C	11: 73,253,008		probably benign	Het
Uggt2	A	T	14: 119,075,329		probably null	Het
Ulk4	A	G	9: 121,044,819	I1182T	probably benign	Het
Uqcc1	A	G	2: 155,910,368	Y98H	probably damaging	Het
Usp25	A	G	16: 77,109,217	I854V	probably benign	Het
Usp50	T	C	2: 126,761,544	S361G	probably damaging	Het
Uspl1	C	A	5: 149,214,815	Q743K	probably damaging	Het
Vmn2r3	A	G	3: 64,275,633	V215A	possibly damaging	Het
Vmn2r61	A	T	7: 42,265,911	H94L	probably benign	Het
Vps37c	T	C	19: 10,713,029	V285A	probably benign	Het
Vwa8	T	C	14: 79,062,676	V983A	probably damaging	Het
Wdr78	T	C	4: 103,103,253	N67D	probably benign	Het
Zcchc9	C	T	13: 91,805,962	R58H	probably benign	Het
Zdbf2	T	C	1: 63,306,143	V1227A	possibly damaging	Het
Zfp292	T	C	4: 34,839,959	K64E	probably damaging	Het
Zfp948	A	G	17: 21,587,502	T319A	probably benign	Het
Zp3r	T	G	1: 130,577,133		probably benign	Het

Other mutations in Dnah2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Dnah2	APN	11	69492672	missense	possibly damaging	0.93
IGL00418:Dnah2	APN	11	69495066	splice site	probably benign
IGL00772:Dnah2	APN	11	69451257	missense	probably damaging	0.97
IGL00819:Dnah2	APN	11	69473350	critical splice donor site	probably null
IGL00827:Dnah2	APN	11	69448457	missense	probably damaging	1.00
IGL01060:Dnah2	APN	11	69478092	missense	possibly damaging	0.86
IGL01340:Dnah2	APN	11	69493184	missense	probably damaging	0.99
IGL01349:Dnah2	APN	11	69475606	missense	probably damaging	0.99
IGL01413:Dnah2	APN	11	69432964	missense	probably damaging	0.99
IGL01451:Dnah2	APN	11	69474191	splice site	probably benign
IGL01480:Dnah2	APN	11	69458371	missense	possibly damaging	0.91
IGL01537:Dnah2	APN	11	69516080	missense	probably benign	0.17
IGL01592:Dnah2	APN	11	69431087	missense	probably benign	0.14
IGL01612:Dnah2	APN	11	69465063	splice site	probably benign
IGL01667:Dnah2	APN	11	69544395	missense	probably benign
IGL01667:Dnah2	APN	11	69520941	missense	probably damaging	0.98
IGL01691:Dnah2	APN	11	69539443	missense	probably benign
IGL02019:Dnah2	APN	11	69474285	missense	probably damaging	1.00
IGL02039:Dnah2	APN	11	69499212	missense	probably damaging	1.00
IGL02076:Dnah2	APN	11	69422559	missense	probably damaging	0.99
IGL02085:Dnah2	APN	11	69458185	missense	probably benign	0.07
IGL02158:Dnah2	APN	11	69458123	missense	probably benign
IGL02381:Dnah2	APN	11	69446292	missense	probably benign	0.25
IGL02681:Dnah2	APN	11	69452933	missense	probably benign	0.40
IGL02957:Dnah2	APN	11	69448507	missense	possibly damaging	0.96
IGL02961:Dnah2	APN	11	69518414	missense	probably damaging	1.00
IGL02969:Dnah2	APN	11	69521187	missense	possibly damaging	0.80
IGL03117:Dnah2	APN	11	69436291	splice site	probably benign
IGL03120:Dnah2	APN	11	69421848	missense	probably damaging	1.00
IGL03183:Dnah2	APN	11	69458488	missense	possibly damaging	0.94
IGL03197:Dnah2	APN	11	69459263	missense	probably damaging	1.00
IGL03263:Dnah2	APN	11	69529381	critical splice donor site	probably null
IGL03333:Dnah2	APN	11	69495123	missense	probably damaging	1.00
IGL03338:Dnah2	APN	11	69496577	missense	probably benign	0.13
argyrios	UTSW	11	69516590	missense	possibly damaging	0.47
Aureus	UTSW	11	69429348	missense	probably damaging	1.00
platinum	UTSW	11	69458042	missense	probably damaging	0.96
R0334_dnah2_144	UTSW	11	69436836	missense	probably damaging	1.00
R2150_dnah2_212	UTSW	11	69515761	missense	probably benign	0.14
BB005:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
BB015:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
E0370:Dnah2	UTSW	11	69515615	splice site	probably null
P0026:Dnah2	UTSW	11	69464947	missense	probably damaging	1.00
R0133:Dnah2	UTSW	11	69421009	missense	probably damaging	1.00
R0190:Dnah2	UTSW	11	69435249	missense	probably damaging	1.00
R0334:Dnah2	UTSW	11	69436836	missense	probably damaging	1.00
R0359:Dnah2	UTSW	11	69529531	missense	probably benign	0.00
R0386:Dnah2	UTSW	11	69447861	missense	probably damaging	1.00
R0414:Dnah2	UTSW	11	69499238	missense	probably benign	0.26
R0427:Dnah2	UTSW	11	69452879	missense	probably damaging	0.99
R0442:Dnah2	UTSW	11	69448542	missense	probably damaging	1.00
R0462:Dnah2	UTSW	11	69459201	missense	probably damaging	1.00
R0463:Dnah2	UTSW	11	69423126	missense	probably damaging	1.00
R0611:Dnah2	UTSW	11	69499194	missense	probably damaging	1.00
R0626:Dnah2	UTSW	11	69477683	missense	probably benign	0.07
R0924:Dnah2	UTSW	11	69421308	missense	probably damaging	1.00
R0968:Dnah2	UTSW	11	69448519	missense	possibly damaging	0.67
R1066:Dnah2	UTSW	11	69447819	missense	probably damaging	1.00
R1183:Dnah2	UTSW	11	69446648	missense	possibly damaging	0.95
R1184:Dnah2	UTSW	11	69499190	missense	probably damaging	1.00
R1186:Dnah2	UTSW	11	69515700	missense	probably damaging	0.99
R1453:Dnah2	UTSW	11	69451050	missense	probably damaging	0.99
R1498:Dnah2	UTSW	11	69520667	splice site	probably null
R1538:Dnah2	UTSW	11	69477202	missense	probably benign	0.17
R1574:Dnah2	UTSW	11	69514688	missense	probably benign	0.26
R1574:Dnah2	UTSW	11	69514688	missense	probably benign	0.26
R1590:Dnah2	UTSW	11	69422754	critical splice donor site	probably null
R1590:Dnah2	UTSW	11	69521198	missense	probably benign	0.00
R1655:Dnah2	UTSW	11	69473854	missense	probably damaging	1.00
R1695:Dnah2	UTSW	11	69514691	missense	possibly damaging	0.74
R1726:Dnah2	UTSW	11	69497889	missense	probably damaging	1.00
R1764:Dnah2	UTSW	11	69423543	missense	probably damaging	1.00
R1815:Dnah2	UTSW	11	69475574	missense	probably damaging	1.00
R1822:Dnah2	UTSW	11	69514804	missense	probably damaging	1.00
R1859:Dnah2	UTSW	11	69437886	missense	probably damaging	0.99
R1911:Dnah2	UTSW	11	69515752	missense	possibly damaging	0.64
R1913:Dnah2	UTSW	11	69464930	missense	probably damaging	1.00
R1981:Dnah2	UTSW	11	69474325	missense	probably damaging	1.00
R2010:Dnah2	UTSW	11	69458358	critical splice donor site	probably null
R2016:Dnah2	UTSW	11	69437070	missense	probably damaging	0.97
R2017:Dnah2	UTSW	11	69437070	missense	probably damaging	0.97
R2044:Dnah2	UTSW	11	69524240	missense	probably benign	0.14
R2077:Dnah2	UTSW	11	69496606	missense	possibly damaging	0.73
R2096:Dnah2	UTSW	11	69455916	missense	probably damaging	0.98
R2099:Dnah2	UTSW	11	69493237	missense	probably damaging	1.00
R2127:Dnah2	UTSW	11	69458185	missense	probably benign	0.02
R2128:Dnah2	UTSW	11	69458185	missense	probably benign	0.02
R2146:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2147:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2150:Dnah2	UTSW	11	69515761	missense	probably benign	0.14
R2404:Dnah2	UTSW	11	69437221	missense	probably damaging	0.99
R2510:Dnah2	UTSW	11	69524206	nonsense	probably null
R2517:Dnah2	UTSW	11	69516644	missense	probably damaging	1.00
R3014:Dnah2	UTSW	11	69430478	missense	probably benign
R3741:Dnah2	UTSW	11	69448469	missense	probably damaging	1.00
R3814:Dnah2	UTSW	11	69492650	splice site	probably null
R3872:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3873:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3874:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3875:Dnah2	UTSW	11	69429348	missense	probably damaging	1.00
R3881:Dnah2	UTSW	11	69451347	missense	possibly damaging	0.94
R3953:Dnah2	UTSW	11	69454103	missense	probably damaging	1.00
R3956:Dnah2	UTSW	11	69484021	missense	probably benign	0.00
R4501:Dnah2	UTSW	11	69477659	missense	probably benign
R4515:Dnah2	UTSW	11	69465631	missense	possibly damaging	0.61
R4612:Dnah2	UTSW	11	69483367	missense	possibly damaging	0.93
R4625:Dnah2	UTSW	11	69463661	missense	probably damaging	1.00
R4627:Dnah2	UTSW	11	69465376	missense	probably damaging	1.00
R4642:Dnah2	UTSW	11	69496559	missense	probably benign	0.00
R4683:Dnah2	UTSW	11	69458942	missense	probably damaging	1.00
R4698:Dnah2	UTSW	11	69498532	missense	probably damaging	1.00
R4710:Dnah2	UTSW	11	69478077	missense	probably damaging	1.00
R4712:Dnah2	UTSW	11	69516590	missense	possibly damaging	0.47
R4713:Dnah2	UTSW	11	69476688	missense	probably damaging	1.00
R4717:Dnah2	UTSW	11	69429357	missense	probably benign	0.00
R4740:Dnah2	UTSW	11	69458042	missense	probably damaging	0.96
R4780:Dnah2	UTSW	11	69473871	missense	probably damaging	0.97
R4825:Dnah2	UTSW	11	69423205	missense	probably damaging	1.00
R4864:Dnah2	UTSW	11	69422590	missense	probably damaging	0.98
R4868:Dnah2	UTSW	11	69463648	missense	probably damaging	1.00
R4879:Dnah2	UTSW	11	69476691	missense	probably damaging	1.00
R4908:Dnah2	UTSW	11	69521147	missense	probably benign	0.00
R4911:Dnah2	UTSW	11	69499104	critical splice donor site	probably null
R4954:Dnah2	UTSW	11	69539496	missense	possibly damaging	0.61
R4962:Dnah2	UTSW	11	69455973	nonsense	probably null
R5015:Dnah2	UTSW	11	69497882	missense	possibly damaging	0.89
R5049:Dnah2	UTSW	11	69448166	missense	probably damaging	1.00
R5055:Dnah2	UTSW	11	69520773	missense	possibly damaging	0.67
R5153:Dnah2	UTSW	11	69520933	missense	possibly damaging	0.84
R5155:Dnah2	UTSW	11	69422536	missense	probably damaging	1.00
R5186:Dnah2	UTSW	11	69435884	missense	probably damaging	1.00
R5187:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5208:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5252:Dnah2	UTSW	11	69529469	missense	probably damaging	0.98
R5296:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5298:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5299:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5301:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5324:Dnah2	UTSW	11	69457993	missense	probably benign	0.07
R5350:Dnah2	UTSW	11	69516036	missense	possibly damaging	0.48
R5377:Dnah2	UTSW	11	69421848	missense	probably damaging	1.00
R5393:Dnah2	UTSW	11	69500857	missense	probably benign
R5421:Dnah2	UTSW	11	69435636	missense	probably damaging	1.00
R5452:Dnah2	UTSW	11	69524383	missense	probably damaging	1.00
R5461:Dnah2	UTSW	11	69473351	critical splice donor site	probably null
R5474:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5476:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5477:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5510:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5527:Dnah2	UTSW	11	69437188	nonsense	probably null
R5566:Dnah2	UTSW	11	69516569	nonsense	probably null
R5587:Dnah2	UTSW	11	69437242	missense	probably damaging	1.00
R5628:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5688:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5690:Dnah2	UTSW	11	69491544	missense	probably benign	0.15
R5711:Dnah2	UTSW	11	69435390	missense	probably damaging	1.00
R5735:Dnah2	UTSW	11	69430817	missense	possibly damaging	0.93
R5826:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5913:Dnah2	UTSW	11	69448430	missense	probably damaging	1.00
R5914:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5960:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5961:Dnah2	UTSW	11	69431148	missense	probably damaging	1.00
R5961:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R5977:Dnah2	UTSW	11	69520881	missense	possibly damaging	0.79
R6020:Dnah2	UTSW	11	69500839	missense	probably benign
R6036:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6036:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6050:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6086:Dnah2	UTSW	11	69516008	missense	probably benign	0.30
R6115:Dnah2	UTSW	11	69446649	missense	probably damaging	1.00
R6123:Dnah2	UTSW	11	69518359	missense	probably benign	0.29
R6159:Dnah2	UTSW	11	69458542	missense	probably damaging	1.00
R6159:Dnah2	UTSW	11	69458920	missense	probably benign	0.15
R6163:Dnah2	UTSW	11	69520903	nonsense	probably null
R6171:Dnah2	UTSW	11	69423042	missense	probably damaging	1.00
R6263:Dnah2	UTSW	11	69457412	missense	probably damaging	1.00
R6298:Dnah2	UTSW	11	69491641	missense	probably benign	0.25
R6352:Dnah2	UTSW	11	69448227	missense	probably damaging	1.00
R6399:Dnah2	UTSW	11	69458518	missense	probably damaging	0.98
R6466:Dnah2	UTSW	11	69539415	missense	probably benign
R6478:Dnah2	UTSW	11	69516010	missense	probably benign	0.01
R6516:Dnah2	UTSW	11	69465386	missense	probably benign	0.34
R6538:Dnah2	UTSW	11	69437197	missense	possibly damaging	0.87
R6802:Dnah2	UTSW	11	69423690	missense	probably damaging	1.00
R6861:Dnah2	UTSW	11	69455963	missense	possibly damaging	0.64
R6869:Dnah2	UTSW	11	69429471	missense	probably damaging	1.00
R6894:Dnah2	UTSW	11	69484260	missense	probably benign	0.12
R6935:Dnah2	UTSW	11	69421741	missense	probably damaging	1.00
R7017:Dnah2	UTSW	11	69491547	nonsense	probably null
R7073:Dnah2	UTSW	11	69430492	nonsense	probably null
R7111:Dnah2	UTSW	11	69446753	splice site	probably null
R7125:Dnah2	UTSW	11	69436182	missense	probably damaging	0.99
R7137:Dnah2	UTSW	11	69491555	missense	probably damaging	1.00
R7190:Dnah2	UTSW	11	69549097	splice site	probably null
R7214:Dnah2	UTSW	11	69431109	missense	probably damaging	1.00
R7227:Dnah2	UTSW	11	69421396	missense	probably damaging	0.99
R7238:Dnah2	UTSW	11	69459146	critical splice donor site	probably null
R7256:Dnah2	UTSW	11	69431094	missense	probably damaging	1.00
R7267:Dnah2	UTSW	11	69500817	missense	probably damaging	1.00
R7420:Dnah2	UTSW	11	69478797	missense	possibly damaging	0.94
R7421:Dnah2	UTSW	11	69492805	missense	probably benign	0.25
R7437:Dnah2	UTSW	11	69498627	missense	probably damaging	1.00
R7461:Dnah2	UTSW	11	69548990	critical splice donor site	probably null
R7473:Dnah2	UTSW	11	69491658	missense	probably damaging	0.99
R7528:Dnah2	UTSW	11	69500796	missense	probably damaging	0.99
R7613:Dnah2	UTSW	11	69548990	critical splice donor site	probably null
R7615:Dnah2	UTSW	11	69435304	missense	probably damaging	0.99
R7626:Dnah2	UTSW	11	69498685	missense	probably damaging	0.99
R7745:Dnah2	UTSW	11	69451318	nonsense	probably null
R7764:Dnah2	UTSW	11	69458158	missense	probably benign	0.29
R7793:Dnah2	UTSW	11	69495214	missense	probably benign	0.00
R7819:Dnah2	UTSW	11	69516593	missense	probably benign	0.01
R7881:Dnah2	UTSW	11	69431238	missense	probably damaging	1.00
R7900:Dnah2	UTSW	11	69518428	missense	probably damaging	1.00
R7916:Dnah2	UTSW	11	69421148	critical splice acceptor site	probably null
R7921:Dnah2	UTSW	11	69520834	missense	probably benign
R7928:Dnah2	UTSW	11	69430835	missense	probably damaging	0.98
R7937:Dnah2	UTSW	11	69517685	nonsense	probably null
R7995:Dnah2	UTSW	11	69520737	missense	possibly damaging	0.77
R8202:Dnah2	UTSW	11	69478823	missense	probably benign	0.00
R8208:Dnah2	UTSW	11	69520852	missense	probably benign	0.05
R8215:Dnah2	UTSW	11	69435367	missense	probably damaging	1.00
R8279:Dnah2	UTSW	11	69475573	missense	probably damaging	1.00
R8338:Dnah2	UTSW	11	69487296	missense	probably damaging	1.00
R8348:Dnah2	UTSW	11	69429447	missense	possibly damaging	0.95
R8405:Dnah2	UTSW	11	69458463	missense	probably damaging	1.00
R8407:Dnah2	UTSW	11	69459278	missense	probably benign	0.00
R8493:Dnah2	UTSW	11	69452978	missense	probably damaging	1.00
R8673:Dnah2	UTSW	11	69514697	missense	probably benign	0.23
R8725:Dnah2	UTSW	11	69524179	missense	probably damaging	1.00
R8727:Dnah2	UTSW	11	69524179	missense	probably damaging	1.00
R8730:Dnah2	UTSW	11	69493261	missense	possibly damaging	0.73
R8804:Dnah2	UTSW	11	69465685	missense	probably benign	0.01
R8876:Dnah2	UTSW	11	69491522	missense	probably damaging	1.00
R8894:Dnah2	UTSW	11	69492222	missense	probably benign	0.01
R8938:Dnah2	UTSW	11	69437928	missense	probably damaging	0.99
R9044:Dnah2	UTSW	11	69529421	missense	probably benign
R9085:Dnah2	UTSW	11	69429398	missense	possibly damaging	0.69
R9110:Dnah2	UTSW	11	69544382	missense	probably benign
R9156:Dnah2	UTSW	11	69422861	missense
R9251:Dnah2	UTSW	11	69515793	missense	probably damaging	1.00
R9258:Dnah2	UTSW	11	69477253	missense	probably damaging	1.00
R9279:Dnah2	UTSW	11	69518278	missense	probably benign	0.01
R9318:Dnah2	UTSW	11	69484329	missense	probably benign	0.07
R9321:Dnah2	UTSW	11	69448113	critical splice donor site	probably null
R9350:Dnah2	UTSW	11	69493247	missense	probably benign	0.10
R9358:Dnah2	UTSW	11	69515766	missense	probably damaging	0.99
R9417:Dnah2	UTSW	11	69436164	missense	probably damaging	1.00
R9420:Dnah2	UTSW	11	69478116	missense	probably benign	0.09
R9438:Dnah2	UTSW	11	69473394	missense	probably damaging	1.00
R9469:Dnah2	UTSW	11	69431070	missense	probably damaging	1.00
R9487:Dnah2	UTSW	11	69515791	missense	possibly damaging	0.47
R9495:Dnah2	UTSW	11	69454382	missense	possibly damaging	0.89
R9579:Dnah2	UTSW	11	69477215	missense	probably damaging	1.00
R9608:Dnah2	UTSW	11	69454062	missense	probably null	1.00
R9651:Dnah2	UTSW	11	69450998	critical splice donor site	probably null
R9662:Dnah2	UTSW	11	69452937	missense	probably benign
RF004:Dnah2	UTSW	11	69437187	missense	probably benign	0.24
U24488:Dnah2	UTSW	11	69483822	missense	probably damaging	0.99
X0021:Dnah2	UTSW	11	69448562	missense	possibly damaging	0.81
Z1088:Dnah2	UTSW	11	69430793	missense	probably damaging	1.00
Z1176:Dnah2	UTSW	11	69421821	missense	possibly damaging	0.46
Z1176:Dnah2	UTSW	11	69451120	missense	probably benign
Z1176:Dnah2	UTSW	11	69487054	missense	possibly damaging	0.46
Z1176:Dnah2	UTSW	11	69498667	missense	probably benign	0.12
Z1176:Dnah2	UTSW	11	69516481	missense	probably damaging	1.00
Z1176:Dnah2	UTSW	11	69516523	missense	probably damaging	1.00
Z1177:Dnah2	UTSW	11	69463453	missense	possibly damaging	0.63
Z1177:Dnah2	UTSW	11	69544557	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCCTGCTCTCACTTGGGAGGATAAC -3'
(R):5'- AGGTGACCACATTCCTGTCTCCTTG -3'

Sequencing Primer
(F):5'- AGGATAACGCCAGCTCTTG -3'
(R):5'- TGCAGTGAATCCCAGAGTTAC -3'

Posted On

2013-05-23