Incidental Mutation 'R5034:Rilpl1'
ID389437
Institutional Source Beutler Lab
Gene Symbol Rilpl1
Ensembl Gene ENSMUSG00000029392
Gene NameRab interacting lysosomal protein-like 1
Synonyms2900002H16Rik, 6330559I19Rik, GOSPEL
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124493080-124531391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124493824 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 153 (D153G)
Ref Sequence ENSEMBL: ENSMUSP00000143250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031349] [ENSMUST00000062153] [ENSMUST00000111453] [ENSMUST00000136567] [ENSMUST00000199125] [ENSMUST00000199766]
Predicted Effect probably benign
Transcript: ENSMUST00000031349
SMART Domains Protein: ENSMUSP00000031349
Gene: ENSMUSG00000029402

DomainStartEndE-ValueType
RRM 52 125 7.24e-21 SMART
low complexity region 132 146 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 224 243 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000062153
AA Change: D366G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050014
Gene: ENSMUSG00000029392
AA Change: D366G

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 27 175 2.3e-47 PFAM
Pfam:RILP 298 351 4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111453
SMART Domains Protein: ENSMUSP00000107080
Gene: ENSMUSG00000029402

DomainStartEndE-ValueType
RRM 52 125 7.24e-21 SMART
low complexity region 132 146 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
low complexity region 224 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136567
SMART Domains Protein: ENSMUSP00000121120
Gene: ENSMUSG00000029402

DomainStartEndE-ValueType
RRM 52 121 6.16e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199125
SMART Domains Protein: ENSMUSP00000142887
Gene: ENSMUSG00000029392

DomainStartEndE-ValueType
coiled coil region 21 65 N/A INTRINSIC
Pfam:RILP 105 164 2.1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199766
AA Change: D153G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143250
Gene: ENSMUSG00000029392
AA Change: D153G

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
Pfam:RILP 77 136 2.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200202
Meta Mutation Damage Score 0.1801 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Rilpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Rilpl1 APN 5 124503649 missense probably damaging 1.00
IGL01727:Rilpl1 APN 5 124530944 missense possibly damaging 0.50
R0973:Rilpl1 UTSW 5 124501871 missense probably benign 0.01
R0973:Rilpl1 UTSW 5 124501888 missense possibly damaging 0.72
R0973:Rilpl1 UTSW 5 124501871 missense probably benign 0.01
R0973:Rilpl1 UTSW 5 124501888 missense possibly damaging 0.72
R0974:Rilpl1 UTSW 5 124501871 missense probably benign 0.01
R0974:Rilpl1 UTSW 5 124501888 missense possibly damaging 0.72
R1056:Rilpl1 UTSW 5 124493837 missense probably damaging 1.00
R1539:Rilpl1 UTSW 5 124515555 missense probably damaging 1.00
R1800:Rilpl1 UTSW 5 124514656 missense probably damaging 1.00
R1928:Rilpl1 UTSW 5 124514750 unclassified probably benign
R4661:Rilpl1 UTSW 5 124514688 missense probably benign 0.32
R4804:Rilpl1 UTSW 5 124493765 missense probably damaging 1.00
R4904:Rilpl1 UTSW 5 124514744 unclassified probably null
R4937:Rilpl1 UTSW 5 124515531 missense possibly damaging 0.64
R6301:Rilpl1 UTSW 5 124514539 missense probably damaging 1.00
R7009:Rilpl1 UTSW 5 124503692 synonymous silent
R7681:Rilpl1 UTSW 5 124530913 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCAGTCCTCAAAGCAGACAGTTC -3'
(R):5'- GAGACCCCAGTGCTTTCTAG -3'

Sequencing Primer
(F):5'- CCTCAAAGCAGACAGTTCGTTTGAG -3'
(R):5'- GAGACCCCAGTGCTTTCTAGAATTC -3'
Posted On2016-06-06