Incidental Mutation 'R0433:Trpv1'
Institutional Source Beutler Lab
Gene Symbol Trpv1
Ensembl Gene ENSMUSG00000005952
Gene Nametransient receptor potential cation channel, subfamily V, member 1
SynonymsOTRPC1, VR-1, capsaicin receptor, Vr1
MMRRC Submission 038635-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R0433 (G1)
Quality Score138
Status Validated
Chromosomal Location73234292-73261242 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 73253008 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006106] [ENSMUST00000102526] [ENSMUST00000108470] [ENSMUST00000138853]
Predicted Effect probably benign
Transcript: ENSMUST00000006106
SMART Domains Protein: ENSMUSP00000006106
Gene: ENSMUSG00000005952

low complexity region 22 35 N/A INTRINSIC
ANK 154 186 1.6e2 SMART
ANK 201 230 5.62e-4 SMART
ANK 248 277 2.3e0 SMART
Blast:ANK 285 321 4e-8 BLAST
Blast:ANK 334 370 6e-9 BLAST
PDB:3J5R|D 339 660 N/A PDB
Blast:PHB 658 704 1e-8 BLAST
PDB:3SUI|B 708 742 1e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000102526
SMART Domains Protein: ENSMUSP00000099585
Gene: ENSMUSG00000005952

low complexity region 22 35 N/A INTRINSIC
ANK 154 186 1.6e2 SMART
ANK 201 230 5.62e-4 SMART
ANK 248 277 2.3e0 SMART
Blast:ANK 285 321 5e-8 BLAST
ANK 333 363 6.17e-1 SMART
Pfam:Ion_trans 432 695 3e-12 PFAM
Blast:PHB 718 764 1e-8 BLAST
PDB:3SUI|B 768 802 1e-15 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108470
SMART Domains Protein: ENSMUSP00000104110
Gene: ENSMUSG00000005952

Blast:ANK 26 62 4e-9 BLAST
Pfam:Ion_trans 111 315 1.8e-8 PFAM
Blast:PHB 350 396 6e-9 BLAST
PDB:3SUI|B 400 434 1e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128113
Predicted Effect probably benign
Transcript: ENSMUST00000138853
SMART Domains Protein: ENSMUSP00000116400
Gene: ENSMUSG00000005952

ANK 25 55 6.17e-1 SMART
Pfam:Ion_trans 171 375 1.8e-8 PFAM
Blast:PHB 410 456 6e-9 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 99% (108/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Capsaicin, the main pungent ingredient in hot chili peppers, elicits a sensation of burning pain by selectively activating sensory neurons that convey information about noxious stimuli to the central nervous system. The protein encoded by this gene is a receptor for capsaicin and is a non-selective cation channel that is structurally related to members of the TRP family of ion channels. This receptor is also activated by increases in temperature in the noxious range, suggesting that it functions as a transducer of painful thermal stimuli in vivo. Four transcript variants encoding the same protein, but with different 5' UTR sequence, have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice demonstrate abnormal nociception, abnormal anxiety- and conditioning-related behaviors, increased sensitivity to DOCA-salt-induced renal damage, resistance to diet-induced obesity, altered taste sensitivity, and impaired febrile response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,303 V199A possibly damaging Het
2410089E03Rik T C 15: 8,216,562 S1473P probably benign Het
Abcb5 T C 12: 118,877,810 M967V probably benign Het
Adcy10 T A 1: 165,552,022 L951Q probably damaging Het
Amer2 A T 14: 60,378,583 S76C probably damaging Het
Atad1 T C 19: 32,698,477 I182M probably benign Het
Bpi A G 2: 158,258,419 D42G probably damaging Het
C7 G T 15: 4,988,916 T815K probably damaging Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Camk1g A G 1: 193,354,058 F165L probably damaging Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccser2 A C 14: 36,918,529 F37L probably damaging Het
Cfap43 A G 19: 47,825,771 F208S probably benign Het
Cfap54 G A 10: 92,979,080 probably benign Het
Cfap69 A C 5: 5,649,853 D62E probably damaging Het
Cnksr2 C A X: 157,888,557 M483I probably benign Het
Cnksr2 A T X: 157,888,558 M483K probably benign Het
Cog8 T C 8: 107,056,478 S60G possibly damaging Het
Col4a3 C T 1: 82,670,219 P484S unknown Het
Col6a4 C T 9: 106,067,994 G974R probably damaging Het
Dbnl T G 11: 5,796,825 probably null Het
Dhcr7 T C 7: 143,840,463 C114R possibly damaging Het
Dnah2 C A 11: 69,459,288 D2340Y probably damaging Het
Dusp10 T A 1: 184,069,196 Y387N probably damaging Het
Eipr1 C T 12: 28,859,331 T199I possibly damaging Het
Emc2 T G 15: 43,497,124 probably null Het
Enpp3 A G 10: 24,820,597 S147P probably benign Het
Fam133b T A 5: 3,558,560 probably benign Het
Fam205c A G 4: 42,874,013 probably benign Het
Fat1 C A 8: 45,024,649 T2244K possibly damaging Het
Fbn1 A G 2: 125,348,215 S1453P possibly damaging Het
Fez2 A T 17: 78,418,047 F13I probably damaging Het
Ggnbp2 T C 11: 84,836,420 K530R probably damaging Het
Gm597 A T 1: 28,777,342 Y536* probably null Het
Gpa33 T C 1: 166,163,761 probably benign Het
Gpr142 T C 11: 114,805,997 I123T probably damaging Het
Il21 T G 3: 37,232,535 I11L possibly damaging Het
Klhl7 A G 5: 24,127,702 E86G probably damaging Het
Klk10 G T 7: 43,781,565 A11S possibly damaging Het
Knl1 A T 2: 119,104,061 D2115V probably damaging Het
Lonp2 A G 8: 86,633,954 D185G probably damaging Het
Lrrc47 T C 4: 154,018,365 probably benign Het
Lrrcc1 A G 3: 14,559,374 I698V probably damaging Het
Lzts2 T C 19: 45,021,676 V83A possibly damaging Het
Melk C A 4: 44,340,614 probably benign Het
Mical1 G A 10: 41,479,490 V150I probably benign Het
Morn3 C A 5: 123,039,333 M129I probably benign Het
Mroh2b T A 15: 4,941,634 D1040E probably benign Het
Mroh5 T C 15: 73,790,028 N438S probably benign Het
Mroh5 T A 15: 73,790,808 Q387L probably damaging Het
Myh15 A G 16: 49,145,236 D1168G probably damaging Het
Nek10 A G 14: 14,860,927 E493G probably benign Het
Nipsnap3a A G 4: 53,000,316 Y227C probably damaging Het
Nlrp9c T A 7: 26,385,819 T112S probably benign Het
Nphp4 T C 4: 152,518,172 V401A probably benign Het
Nr1h2 A G 7: 44,549,987 *365Q probably null Het
Olfr1339 T C 4: 118,735,090 V187A probably benign Het
Olfr474 T C 7: 107,955,262 I207T probably damaging Het
Pacs2 T A 12: 113,056,844 V279D possibly damaging Het
Pdcd2 C T 17: 15,526,384 C171Y probably benign Het
Pde11a T A 2: 76,337,706 D301V possibly damaging Het
Pfpl T G 19: 12,429,475 N363K probably damaging Het
Phf14 T A 6: 11,933,743 S201R probably damaging Het
Pip4k2c G A 10: 127,208,946 P66S probably benign Het
Pou2f3 G T 9: 43,127,398 H392N probably benign Het
Pou3f1 G T 4: 124,658,904 G400C probably damaging Het
Ptprg T C 14: 12,220,620 I1219T probably damaging Het
Rfx6 A G 10: 51,720,028 D435G probably damaging Het
Rhpn2 T A 7: 35,385,474 S598T probably benign Het
Sdccag8 C A 1: 176,844,821 probably null Het
Sec16b C A 1: 157,534,709 Y43* probably null Het
Sele T C 1: 164,049,244 Y30H possibly damaging Het
Sgsm2 C T 11: 74,858,190 probably null Het
Slc45a2 T C 15: 11,025,745 Y394H probably benign Het
Slc4a10 T G 2: 62,289,983 I788S probably benign Het
Slmap A T 14: 26,453,594 L161* probably null Het
Slx4 A T 16: 3,986,018 D977E probably benign Het
Spen A T 4: 141,483,758 M608K unknown Het
St8sia4 G C 1: 95,591,704 T353R probably damaging Het
Stab2 G T 10: 86,843,491 probably benign Het
Stx12 C T 4: 132,858,430 G213D probably damaging Het
Synj2 A T 17: 6,033,848 N270Y probably damaging Het
Tdrd9 C T 12: 112,025,581 R438* probably null Het
Tert T C 13: 73,627,081 Y18H probably damaging Het
Tph1 A T 7: 46,653,821 F244L probably damaging Het
Triobp T C 15: 78,968,201 F852L possibly damaging Het
Uggt2 A T 14: 119,075,329 probably null Het
Ulk4 A G 9: 121,044,819 I1182T probably benign Het
Uqcc1 A G 2: 155,910,368 Y98H probably damaging Het
Usp25 A G 16: 77,109,217 I854V probably benign Het
Usp50 T C 2: 126,761,544 S361G probably damaging Het
Uspl1 C A 5: 149,214,815 Q743K probably damaging Het
Vmn2r3 A G 3: 64,275,633 V215A possibly damaging Het
Vmn2r61 A T 7: 42,265,911 H94L probably benign Het
Vps37c T C 19: 10,713,029 V285A probably benign Het
Vwa8 T C 14: 79,062,676 V983A probably damaging Het
Wdr78 T C 4: 103,103,253 N67D probably benign Het
Zcchc9 C T 13: 91,805,962 R58H probably benign Het
Zdbf2 T C 1: 63,306,143 V1227A possibly damaging Het
Zfp292 T C 4: 34,839,959 K64E probably damaging Het
Zfp948 A G 17: 21,587,502 T319A probably benign Het
Zp3r T G 1: 130,577,133 probably benign Het
Other mutations in Trpv1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Trpv1 APN 11 73260362 missense probably damaging 0.99
IGL01348:Trpv1 APN 11 73238252 unclassified probably null
IGL01568:Trpv1 APN 11 73238443 missense probably benign 0.01
IGL01638:Trpv1 APN 11 73253329 missense probably damaging 0.98
IGL02092:Trpv1 APN 11 73246079 splice site probably benign
IGL02167:Trpv1 APN 11 73254797 missense probably damaging 1.00
IGL02649:Trpv1 APN 11 73250786 missense probably damaging 1.00
IGL03396:Trpv1 APN 11 73253056 missense probably benign 0.01
IGL03402:Trpv1 APN 11 73239637 missense possibly damaging 0.73
R0112:Trpv1 UTSW 11 73253272 missense probably damaging 1.00
R0482:Trpv1 UTSW 11 73239429 missense probably damaging 1.00
R0494:Trpv1 UTSW 11 73260442 missense probably benign
R1401:Trpv1 UTSW 11 73240126 splice site probably null
R2032:Trpv1 UTSW 11 73238385 missense probably benign
R2199:Trpv1 UTSW 11 73240251 missense probably damaging 0.96
R2263:Trpv1 UTSW 11 73241682 missense probably damaging 1.00
R2939:Trpv1 UTSW 11 73254849 missense probably damaging 0.99
R2940:Trpv1 UTSW 11 73254849 missense probably damaging 0.99
R3743:Trpv1 UTSW 11 73254302 missense probably damaging 1.00
R3805:Trpv1 UTSW 11 73253053 missense probably damaging 0.99
R4073:Trpv1 UTSW 11 73250780 missense probably damaging 0.96
R4294:Trpv1 UTSW 11 73240464 missense probably damaging 1.00
R4650:Trpv1 UTSW 11 73238263 missense probably benign 0.04
R4700:Trpv1 UTSW 11 73251284 missense possibly damaging 0.47
R5114:Trpv1 UTSW 11 73241748 missense probably damaging 1.00
R5153:Trpv1 UTSW 11 73238516 missense probably benign 0.32
R5319:Trpv1 UTSW 11 73239589 missense probably damaging 0.99
R5516:Trpv1 UTSW 11 73245983 missense probably benign 0.44
R5845:Trpv1 UTSW 11 73240581 missense probably damaging 1.00
R6134:Trpv1 UTSW 11 73244317 missense probably benign 0.01
R6232:Trpv1 UTSW 11 73250810 missense possibly damaging 0.88
R6383:Trpv1 UTSW 11 73246036 missense probably damaging 1.00
R7200:Trpv1 UTSW 11 73239586 missense probably damaging 1.00
R7319:Trpv1 UTSW 11 73250794 missense probably benign 0.01
R7323:Trpv1 UTSW 11 73260337 missense possibly damaging 0.82
R7361:Trpv1 UTSW 11 73260377 missense probably damaging 0.99
R7373:Trpv1 UTSW 11 73240673 missense probably damaging 1.00
R7444:Trpv1 UTSW 11 73244204 missense possibly damaging 0.89
R7488:Trpv1 UTSW 11 73238529 missense probably benign 0.00
R7513:Trpv1 UTSW 11 73240541 missense probably damaging 1.00
R7762:Trpv1 UTSW 11 73254222 missense probably benign 0.01
X0067:Trpv1 UTSW 11 73244201 critical splice acceptor site probably null
Z1176:Trpv1 UTSW 11 73240188 missense probably damaging 1.00
Z1176:Trpv1 UTSW 11 73240507 missense probably damaging 1.00
Z1177:Trpv1 UTSW 11 73254773 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tttcttcaaacacttcgcctac -3'
Posted On2013-05-23