Incidental Mutation 'R5034:Dennd5a'
ID389447
Institutional Source Beutler Lab
Gene Symbol Dennd5a
Ensembl Gene ENSMUSG00000035901
Gene NameDENN/MADD domain containing 5A
Synonyms1500012B19Rik, Rab6ip1, ORF37
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109893780-109960470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109899797 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 953 (I953N)
Ref Sequence ENSEMBL: ENSMUSP00000102333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080437] [ENSMUST00000106722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080437
AA Change: I977N

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000079295
Gene: ENSMUSG00000035901
AA Change: I977N

DomainStartEndE-ValueType
uDENN 12 138 7.71e-45 SMART
DENN 202 390 9.28e-80 SMART
dDENN 512 588 4.06e-21 SMART
low complexity region 832 844 N/A INTRINSIC
RUN 884 947 4.9e-22 SMART
Pfam:PLAT 956 1062 1e-15 PFAM
RUN 1218 1278 3.69e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106722
AA Change: I953N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102333
Gene: ENSMUSG00000035901
AA Change: I953N

DomainStartEndE-ValueType
uDENN 12 114 2.32e-39 SMART
DENN 178 366 9.28e-80 SMART
dDENN 488 564 4.06e-21 SMART
low complexity region 808 820 N/A INTRINSIC
RUN 860 923 4.9e-22 SMART
Pfam:PLAT 932 1038 2.8e-18 PFAM
RUN 1194 1254 3.69e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156858
Meta Mutation Damage Score 0.6176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN-domain-containing protein that functions as a RAB-activating guanine nucleotide exchange factor (GEF). This protein catalyzes the conversion of GDP to GTP and thereby converts inactive GDP-bound Rab proteins into their active GTP-bound form. The encoded protein is recruited by RAB6 onto Golgi membranes and is therefore referred to as RAB6-interacting protein 1. This protein binds with RAB39 as well. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene are associated with early infantile epileptic encephalopathy-49. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Dennd5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Dennd5a APN 7 109908372 missense probably benign
IGL01338:Dennd5a APN 7 109919404 missense possibly damaging 0.92
IGL01618:Dennd5a APN 7 109934095 missense probably damaging 1.00
IGL02047:Dennd5a APN 7 109934784 missense possibly damaging 0.92
IGL02277:Dennd5a APN 7 109897969 missense possibly damaging 0.61
IGL02492:Dennd5a APN 7 109933637 missense probably benign
IGL02697:Dennd5a APN 7 109894781 missense probably damaging 1.00
IGL02935:Dennd5a APN 7 109921307 missense possibly damaging 0.80
IGL02986:Dennd5a APN 7 109935524 missense probably benign
IGL03088:Dennd5a APN 7 109908381 missense probably damaging 1.00
IGL03156:Dennd5a APN 7 109919255 splice site probably benign
IGL03181:Dennd5a APN 7 109933658 missense probably damaging 1.00
big_pal UTSW 7 109919423 nonsense probably null
celestial UTSW 7 109901089 missense probably damaging 1.00
PIT4434001:Dennd5a UTSW 7 109933624 missense probably damaging 1.00
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0055:Dennd5a UTSW 7 109899791 missense possibly damaging 0.72
R0092:Dennd5a UTSW 7 109899806 missense possibly damaging 0.95
R0111:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R0517:Dennd5a UTSW 7 109934761 missense probably damaging 1.00
R0546:Dennd5a UTSW 7 109921426 missense probably benign 0.01
R0811:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0812:Dennd5a UTSW 7 109933613 missense possibly damaging 0.93
R0827:Dennd5a UTSW 7 109899731 missense probably damaging 1.00
R0831:Dennd5a UTSW 7 109934754 missense probably damaging 1.00
R1075:Dennd5a UTSW 7 109918601 missense probably benign
R1115:Dennd5a UTSW 7 109918761 missense probably damaging 1.00
R1128:Dennd5a UTSW 7 109921334 nonsense probably null
R1300:Dennd5a UTSW 7 109919407 missense probably benign
R1698:Dennd5a UTSW 7 109917380 splice site probably null
R1711:Dennd5a UTSW 7 109918712 missense probably benign 0.00
R1771:Dennd5a UTSW 7 109918686 missense probably damaging 0.98
R1803:Dennd5a UTSW 7 109898613 missense probably benign 0.00
R2064:Dennd5a UTSW 7 109898693 splice site probably benign
R2176:Dennd5a UTSW 7 109905120 intron probably null
R2182:Dennd5a UTSW 7 109933994 missense probably benign 0.03
R2852:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R2853:Dennd5a UTSW 7 109933671 missense probably damaging 1.00
R3035:Dennd5a UTSW 7 109921352 missense probably benign 0.00
R3835:Dennd5a UTSW 7 109934242 missense probably benign 0.00
R3953:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3954:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3955:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R3957:Dennd5a UTSW 7 109905699 missense probably benign 0.44
R4014:Dennd5a UTSW 7 109935481 critical splice donor site probably null
R4166:Dennd5a UTSW 7 109926825 critical splice donor site probably null
R4362:Dennd5a UTSW 7 109896343 missense probably damaging 1.00
R4567:Dennd5a UTSW 7 109899735 missense probably benign 0.06
R4700:Dennd5a UTSW 7 109921198 missense probably benign 0.01
R4734:Dennd5a UTSW 7 109896336 missense probably damaging 0.96
R4914:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4915:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4918:Dennd5a UTSW 7 109901089 missense probably damaging 1.00
R4992:Dennd5a UTSW 7 109894712 missense probably damaging 0.98
R5011:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5013:Dennd5a UTSW 7 109914776 missense possibly damaging 0.89
R5194:Dennd5a UTSW 7 109933729 missense probably damaging 1.00
R5359:Dennd5a UTSW 7 109897962 missense probably damaging 1.00
R5430:Dennd5a UTSW 7 109934240 missense probably damaging 1.00
R5586:Dennd5a UTSW 7 109905721 missense possibly damaging 0.72
R5607:Dennd5a UTSW 7 109919423 nonsense probably null
R5608:Dennd5a UTSW 7 109919423 nonsense probably null
R5783:Dennd5a UTSW 7 109894636 missense probably damaging 0.97
R5866:Dennd5a UTSW 7 109919360 missense probably benign 0.00
R5890:Dennd5a UTSW 7 109934221 missense probably benign 0.00
R6053:Dennd5a UTSW 7 109933745 missense probably damaging 1.00
R6247:Dennd5a UTSW 7 109898682 missense probably damaging 1.00
R6362:Dennd5a UTSW 7 109934265 nonsense probably null
R6446:Dennd5a UTSW 7 109894666 missense probably damaging 1.00
R6894:Dennd5a UTSW 7 109901118 missense probably damaging 1.00
R7061:Dennd5a UTSW 7 109905179 missense probably benign 0.19
R7115:Dennd5a UTSW 7 109894754 missense probably damaging 1.00
R7133:Dennd5a UTSW 7 109896242 critical splice donor site probably null
R7302:Dennd5a UTSW 7 109905699 missense probably damaging 0.98
R7339:Dennd5a UTSW 7 109901159 missense probably damaging 1.00
R7704:Dennd5a UTSW 7 109896967 missense possibly damaging 0.85
R7756:Dennd5a UTSW 7 109921507 missense possibly damaging 0.95
R7838:Dennd5a UTSW 7 109933989 missense probably benign
R7873:Dennd5a UTSW 7 109926934 missense probably damaging 1.00
R7921:Dennd5a UTSW 7 109933989 missense probably benign
R7956:Dennd5a UTSW 7 109926934 missense probably damaging 1.00
Z1088:Dennd5a UTSW 7 109894747 missense possibly damaging 0.73
Z1088:Dennd5a UTSW 7 109905273 missense probably damaging 1.00
Z1177:Dennd5a UTSW 7 109934024 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAACAAGGCCTCTACGATG -3'
(R):5'- CTGATATGTGAAGCAGCCAGG -3'

Sequencing Primer
(F):5'- GATGTCCTGCAGAAAATTCCTACGG -3'
(R):5'- GGGATCTGCTGGCAATAGC -3'
Posted On2016-06-06