Incidental Mutation 'R5034:Ubash3b'
ID389449
Institutional Source Beutler Lab
Gene Symbol Ubash3b
Ensembl Gene ENSMUSG00000032020
Gene Nameubiquitin associated and SH3 domain containing, B
Synonyms2810457I06Rik, TULA-2
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location41011098-41161697 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41029740 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 245 (Q245R)
Ref Sequence ENSEMBL: ENSMUSP00000116038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044155] [ENSMUST00000151485]
Predicted Effect probably benign
Transcript: ENSMUST00000044155
AA Change: Q367R

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043865
Gene: ENSMUSG00000032020
AA Change: Q367R

DomainStartEndE-ValueType
UBA 26 64 2.43e-4 SMART
low complexity region 177 186 N/A INTRINSIC
SH3 246 307 7.29e-10 SMART
Pfam:His_Phos_1 415 598 3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151485
AA Change: Q245R

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000116038
Gene: ENSMUSG00000032020
AA Change: Q245R

DomainStartEndE-ValueType
low complexity region 55 64 N/A INTRINSIC
SH3 124 185 7.29e-10 SMART
Pfam:His_Phos_1 252 450 1.9e-27 PFAM
Meta Mutation Damage Score 0.1495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a ubiquitin associated domain at the N-terminus, an SH3 domain, and a C-terminal domain with similarities to the catalytic motif of phosphoglycerate mutase. The encoded protein was found to inhibit endocytosis of epidermal growth factor receptor (EGFR) and platelet-derived growth factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, developmentally normal, and do not display any obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Ubash3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Ubash3b APN 9 41018015 critical splice donor site probably null
IGL01734:Ubash3b APN 9 41026247 splice site probably benign
IGL02311:Ubash3b APN 9 41047037 missense probably benign
IGL03406:Ubash3b APN 9 41037479 missense probably damaging 1.00
PIT4618001:Ubash3b UTSW 9 41016627 missense probably benign 0.00
PIT4687001:Ubash3b UTSW 9 41023518 missense probably damaging 1.00
R0524:Ubash3b UTSW 9 41016608 missense probably benign 0.16
R0666:Ubash3b UTSW 9 41047064 missense possibly damaging 0.67
R0927:Ubash3b UTSW 9 41023557 nonsense probably null
R1112:Ubash3b UTSW 9 41028116 missense probably damaging 1.00
R1544:Ubash3b UTSW 9 41016605 missense probably damaging 1.00
R1596:Ubash3b UTSW 9 41031497 missense probably benign
R1610:Ubash3b UTSW 9 41043500 missense probably damaging 1.00
R2069:Ubash3b UTSW 9 41043573 missense possibly damaging 0.82
R2507:Ubash3b UTSW 9 41157354 missense possibly damaging 0.90
R2520:Ubash3b UTSW 9 41014947 missense probably damaging 1.00
R3899:Ubash3b UTSW 9 41031564 missense probably benign 0.00
R3900:Ubash3b UTSW 9 41031564 missense probably benign 0.00
R4715:Ubash3b UTSW 9 41016600 missense probably damaging 1.00
R4876:Ubash3b UTSW 9 41018109 missense probably benign 0.00
R5023:Ubash3b UTSW 9 41037459 missense possibly damaging 0.90
R5057:Ubash3b UTSW 9 41037459 missense possibly damaging 0.90
R5396:Ubash3b UTSW 9 41043473 critical splice donor site probably null
R5448:Ubash3b UTSW 9 41037435 critical splice donor site probably null
R5760:Ubash3b UTSW 9 41077423 missense probably benign 0.00
R6178:Ubash3b UTSW 9 41014916 missense probably damaging 0.96
R6392:Ubash3b UTSW 9 41014972 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTTACTAGGTTTAGACTAGCTGTG -3'
(R):5'- TACCCTCCTGTTGCAGTAGG -3'

Sequencing Primer
(F):5'- CTAGCTGTGGGTGAACGAAACC -3'
(R):5'- TGCAGGTACCTCATGGGAG -3'
Posted On2016-06-06