Incidental Mutation 'R5034:Sept8'
ID389453
Institutional Source Beutler Lab
Gene Symbol Sept8
Ensembl Gene ENSMUSG00000018398
Gene Nameseptin 8
SynonymsSepl
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location53519257-53549565 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53534438 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 53 (T53A)
Ref Sequence ENSEMBL: ENSMUSP00000113038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108987] [ENSMUST00000117061] [ENSMUST00000120878] [ENSMUST00000121334] [ENSMUST00000142800] [ENSMUST00000147912]
Predicted Effect probably damaging
Transcript: ENSMUST00000108987
AA Change: T53A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104615
Gene: ENSMUSG00000018398
AA Change: T53A

DomainStartEndE-ValueType
Pfam:Septin 41 314 1.9e-101 PFAM
Pfam:MMR_HSR1 46 191 5.7e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117061
AA Change: T53A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112920
Gene: ENSMUSG00000018398
AA Change: T53A

DomainStartEndE-ValueType
Pfam:Septin 41 314 6.5e-101 PFAM
Pfam:MMR_HSR1 46 191 1.3e-6 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120878
AA Change: T53A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113775
Gene: ENSMUSG00000018398
AA Change: T53A

DomainStartEndE-ValueType
Pfam:Septin 41 312 6.4e-98 PFAM
Pfam:MMR_HSR1 46 190 6.3e-7 PFAM
low complexity region 349 372 N/A INTRINSIC
low complexity region 377 392 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121334
AA Change: T53A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113038
Gene: ENSMUSG00000018398
AA Change: T53A

DomainStartEndE-ValueType
Pfam:Septin 41 314 1.9e-100 PFAM
Pfam:MMR_HSR1 46 187 2.6e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142800
SMART Domains Protein: ENSMUSP00000124057
Gene: ENSMUSG00000018398

DomainStartEndE-ValueType
Pfam:Septin 1 51 5.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145927
Predicted Effect probably damaging
Transcript: ENSMUST00000147912
AA Change: T53A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120427
Gene: ENSMUSG00000018398
AA Change: T53A

DomainStartEndE-ValueType
Pfam:Septin 41 314 2.1e-101 PFAM
Pfam:MMR_HSR1 46 190 6e-7 PFAM
low complexity region 351 374 N/A INTRINSIC
low complexity region 379 394 N/A INTRINSIC
Meta Mutation Damage Score 0.6042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit myelin outfoldings and reduced nerve conduction velocity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Sept8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Sept8 APN 11 53531996 missense probably benign 0.08
IGL01649:Sept8 APN 11 53535028 missense possibly damaging 0.79
IGL02131:Sept8 APN 11 53537857 missense possibly damaging 0.79
IGL02547:Sept8 APN 11 53537265 missense probably damaging 1.00
R0856:Sept8 UTSW 11 53537870 missense probably benign 0.01
R0908:Sept8 UTSW 11 53537870 missense probably benign 0.01
R1799:Sept8 UTSW 11 53534483 missense probably benign 0.32
R3774:Sept8 UTSW 11 53537579 missense probably damaging 1.00
R4747:Sept8 UTSW 11 53536718 missense probably damaging 1.00
R4810:Sept8 UTSW 11 53534589 missense probably damaging 0.97
R5313:Sept8 UTSW 11 53535982 missense probably damaging 1.00
R5652:Sept8 UTSW 11 53537217 missense probably damaging 1.00
R6263:Sept8 UTSW 11 53548383 missense probably benign 0.00
R6285:Sept8 UTSW 11 53534767 intron probably null
R6289:Sept8 UTSW 11 53534478 missense probably damaging 0.99
R6571:Sept8 UTSW 11 53537163 missense probably damaging 1.00
R7238:Sept8 UTSW 11 53536692 missense possibly damaging 0.68
R7249:Sept8 UTSW 11 53535122 missense probably damaging 0.97
R7646:Sept8 UTSW 11 53537917 critical splice donor site probably null
R7691:Sept8 UTSW 11 53537587 missense probably benign 0.00
X0024:Sept8 UTSW 11 53536724 nonsense probably null
X0058:Sept8 UTSW 11 53535085 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCATGACAGGGCAAGTTGAG -3'
(R):5'- ATTGATCTGATCGCCAAAGCC -3'

Sequencing Primer
(F):5'- GGCCTTACACATGTCAGGCAAG -3'
(R):5'- CCACAGCATCCACGATGGTC -3'
Posted On2016-06-06