Incidental Mutation 'R5034:Pphln1'
ID389469
Institutional Source Beutler Lab
Gene Symbol Pphln1
Ensembl Gene ENSMUSG00000036167
Gene Nameperiphilin 1
SynonymsCR, 1600022A19Rik, 1110063K05Rik
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location93398350-93491510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93452129 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 120 (V120A)
Ref Sequence ENSEMBL: ENSMUSP00000068165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049122] [ENSMUST00000068457] [ENSMUST00000109256] [ENSMUST00000165935] [ENSMUST00000229071]
Predicted Effect probably benign
Transcript: ENSMUST00000049122
AA Change: V189A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042762
Gene: ENSMUSG00000036167
AA Change: V189A

DomainStartEndE-ValueType
low complexity region 35 59 N/A INTRINSIC
low complexity region 154 174 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
Pfam:Lge1 275 365 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068457
AA Change: V120A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068165
Gene: ENSMUSG00000036167
AA Change: V120A

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
Pfam:Lge1 179 297 8.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109256
SMART Domains Protein: ENSMUSP00000104879
Gene: ENSMUSG00000036167

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165935
SMART Domains Protein: ENSMUSP00000131121
Gene: ENSMUSG00000036167

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229071
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the several proteins that become sequentially incorporated into the cornified cell envelope during the terminal differentiation of keratinocyte at the outer layers of epidermis. This protein interacts with periplakin, which is known as a precursor of the cornified cell envelope. The cellular localization pattern and insolubility of this protein suggest that it may play a role in epithelial differentiation and contribute to epidermal integrity and barrier formation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Pphln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Pphln1 APN 15 93465210 missense probably damaging 1.00
IGL01305:Pphln1 APN 15 93489104 missense probably damaging 1.00
IGL01651:Pphln1 APN 15 93488983 missense probably damaging 1.00
IGL03219:Pphln1 APN 15 93465255 splice site probably benign
ANU22:Pphln1 UTSW 15 93489104 missense probably damaging 1.00
R0294:Pphln1 UTSW 15 93420290 missense probably damaging 1.00
R0309:Pphln1 UTSW 15 93441707 missense possibly damaging 0.55
R0645:Pphln1 UTSW 15 93420311 missense possibly damaging 0.80
R1208:Pphln1 UTSW 15 93459729 missense probably damaging 1.00
R1208:Pphln1 UTSW 15 93459729 missense probably damaging 1.00
R1879:Pphln1 UTSW 15 93424046 missense probably damaging 0.99
R1936:Pphln1 UTSW 15 93488987 missense possibly damaging 0.79
R4049:Pphln1 UTSW 15 93465106 missense probably damaging 0.99
R5472:Pphln1 UTSW 15 93488975 missense possibly damaging 0.89
R5945:Pphln1 UTSW 15 93455532 critical splice donor site probably null
R7116:Pphln1 UTSW 15 93455525 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GGAGCCAGTGCAGTATGTTC -3'
(R):5'- GACAGCTGTATTGCTATCCAACC -3'

Sequencing Primer
(F):5'- AGCCAGTGCAGTATGTTCTGTCC -3'
(R):5'- TATCCAACCTTGCCGACAGTGG -3'
Posted On2016-06-06