Incidental Mutation 'R5034:Dsc1'
ID389473
Institutional Source Beutler Lab
Gene Symbol Dsc1
Ensembl Gene ENSMUSG00000044322
Gene Namedesmocollin 1
SynonymsDsc1a, Dsc1b
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20084184-20114871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20095027 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 424 (Y424F)
Ref Sequence ENSEMBL: ENSMUSP00000042303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038710
AA Change: Y424F

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: Y424F

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Cadherin_pro 29 111 2.61e-41 SMART
CA 155 240 2.78e-9 SMART
CA 264 352 5.94e-27 SMART
CA 375 470 5.27e-10 SMART
CA 493 575 1.18e-21 SMART
Blast:CA 593 672 5e-46 BLAST
transmembrane domain 692 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224432
AA Change: Y424F

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224557
Meta Mutation Damage Score 0.1910 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Dsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Dsc1 APN 18 20101886 missense probably damaging 1.00
IGL00571:Dsc1 APN 18 20110138 missense probably damaging 1.00
IGL00790:Dsc1 APN 18 20094896 missense probably damaging 1.00
IGL00963:Dsc1 APN 18 20111986 missense probably null 0.01
IGL00972:Dsc1 APN 18 20088363 missense probably benign 0.32
IGL01112:Dsc1 APN 18 20094622 missense probably benign 0.02
IGL01458:Dsc1 APN 18 20099138 missense probably damaging 1.00
IGL01607:Dsc1 APN 18 20089663 missense probably damaging 1.00
IGL01794:Dsc1 APN 18 20110183 missense probably damaging 1.00
IGL01959:Dsc1 APN 18 20097225 missense probably damaging 1.00
IGL02066:Dsc1 APN 18 20108803 unclassified probably benign
IGL02365:Dsc1 APN 18 20108816 missense probably damaging 1.00
IGL02714:Dsc1 APN 18 20087485 missense probably damaging 1.00
IGL02959:Dsc1 APN 18 20108885 missense probably damaging 1.00
IGL03019:Dsc1 APN 18 20088364 missense probably benign 0.00
IGL03106:Dsc1 APN 18 20086644 splice site probably null
R0414:Dsc1 UTSW 18 20088354 missense possibly damaging 0.85
R0456:Dsc1 UTSW 18 20099112 missense probably damaging 1.00
R0612:Dsc1 UTSW 18 20114516 missense probably damaging 0.96
R0630:Dsc1 UTSW 18 20085862 missense probably damaging 1.00
R0646:Dsc1 UTSW 18 20096057 missense probably damaging 1.00
R0928:Dsc1 UTSW 18 20110249 splice site probably null
R0976:Dsc1 UTSW 18 20095041 splice site probably null
R1221:Dsc1 UTSW 18 20114542 nonsense probably null
R1398:Dsc1 UTSW 18 20088336 missense probably damaging 1.00
R1902:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R1903:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R2070:Dsc1 UTSW 18 20088296 splice site probably null
R2119:Dsc1 UTSW 18 20110152 missense probably benign 0.07
R3935:Dsc1 UTSW 18 20097241 missense probably benign 0.00
R4747:Dsc1 UTSW 18 20094558 missense probably damaging 1.00
R5243:Dsc1 UTSW 18 20099159 missense probably damaging 1.00
R5289:Dsc1 UTSW 18 20101853 missense possibly damaging 0.72
R5300:Dsc1 UTSW 18 20094860 missense probably damaging 1.00
R5354:Dsc1 UTSW 18 20087575 missense probably damaging 1.00
R5376:Dsc1 UTSW 18 20088446 missense probably benign 0.21
R5808:Dsc1 UTSW 18 20086829 nonsense probably null
R5860:Dsc1 UTSW 18 20095024 missense probably damaging 1.00
R6059:Dsc1 UTSW 18 20110242 missense probably damaging 0.98
R6116:Dsc1 UTSW 18 20097299 missense probably benign 0.10
R6351:Dsc1 UTSW 18 20086769 missense probably damaging 1.00
R6422:Dsc1 UTSW 18 20095033 missense probably damaging 1.00
R6811:Dsc1 UTSW 18 20089654 missense probably benign
R6880:Dsc1 UTSW 18 20088372 missense probably damaging 0.99
R6941:Dsc1 UTSW 18 20097189 missense probably benign 0.00
R6997:Dsc1 UTSW 18 20086644 splice site probably null
R7255:Dsc1 UTSW 18 20097273 missense probably benign 0.12
R7456:Dsc1 UTSW 18 20086822 missense probably benign 0.00
R7492:Dsc1 UTSW 18 20107680 missense possibly damaging 0.46
R7503:Dsc1 UTSW 18 20085865 missense probably damaging 1.00
R8030:Dsc1 UTSW 18 20089571 missense not run
Z1176:Dsc1 UTSW 18 20114538 missense not run
Predicted Primers PCR Primer
(F):5'- TGCTCTGAATGACTTTGACTGG -3'
(R):5'- AAGGTGGGATCTTCCAAAGC -3'

Sequencing Primer
(F):5'- TGACTGGTGGCTGGCACTC -3'
(R):5'- GTAGGAAGGAAAATGGTCAATTCTC -3'
Posted On2016-06-06