Incidental Mutation 'R5034:Sra1'
ID389475
Institutional Source Beutler Lab
Gene Symbol Sra1
Ensembl Gene ENSMUSG00000006050
Gene Namesteroid receptor RNA activator 1
SynonymsSrap
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36666681-36679366 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 36678995 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001415] [ENSMUST00000036158] [ENSMUST00000050476] [ENSMUST00000185899] [ENSMUST00000186538]
Predicted Effect probably null
Transcript: ENSMUST00000001415
SMART Domains Protein: ENSMUSP00000001415
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
WW 30 61 1.72e-7 SMART
low complexity region 85 100 N/A INTRINSIC
PTB 114 260 7.64e-37 SMART
PTB 286 420 4.07e-32 SMART
low complexity region 444 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036158
SMART Domains Protein: ENSMUSP00000036081
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 36 321 6.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050476
SMART Domains Protein: ENSMUSP00000129718
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170288
Predicted Effect probably benign
Transcript: ENSMUST00000185899
SMART Domains Protein: ENSMUSP00000140201
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:DUF4535 63 101 3.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186538
SMART Domains Protein: ENSMUSP00000140615
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Meta Mutation Damage Score 0.9502 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Both long non-coding and protein-coding RNAs are transcribed from this gene, and they represent alternatively spliced transcript variants. This gene was initially defined as a non-coding RNA, which is a coactivator for several nuclear receptors (NRs) and is associated with breast cancer. It has now been found that this gene is involved in the regulation of many NR and non-NR activities, including metabolism, adipogenesis and chromatin organization. The long non-coding RNA transcripts interact with a variety of proteins, including the protein encoded by this gene. The encoded protein acts as a transcriptional repressor by binding to the non-coding RNA. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous null mice are protected against diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Sra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Sra1 APN 18 36668739 missense probably benign 0.36
IGL01390:Sra1 APN 18 36670081 missense probably damaging 1.00
IGL01645:Sra1 APN 18 36671473 missense probably damaging 1.00
IGL02478:Sra1 APN 18 36668792 missense probably benign 0.00
IGL02578:Sra1 APN 18 36670097 nonsense probably null
R0218:Sra1 UTSW 18 36676609 unclassified probably benign
R0243:Sra1 UTSW 18 36675706 nonsense probably null
R0432:Sra1 UTSW 18 36677503 missense probably benign
R0834:Sra1 UTSW 18 36668776 missense probably benign 0.00
R1886:Sra1 UTSW 18 36668777 missense probably benign
R2105:Sra1 UTSW 18 36675068 missense probably benign 0.00
R2911:Sra1 UTSW 18 36676185 missense possibly damaging 0.49
R4951:Sra1 UTSW 18 36676441 nonsense probably null
R5091:Sra1 UTSW 18 36669959 intron probably benign
R5122:Sra1 UTSW 18 36667594 missense probably benign 0.03
R5656:Sra1 UTSW 18 36678407 missense probably damaging 0.99
R5722:Sra1 UTSW 18 36674978 missense probably damaging 1.00
R5726:Sra1 UTSW 18 36670173 intron probably benign
R5729:Sra1 UTSW 18 36667443 utr 3 prime probably benign
R5937:Sra1 UTSW 18 36671599 unclassified probably null
R6145:Sra1 UTSW 18 36667575 missense probably damaging 1.00
R6161:Sra1 UTSW 18 36670283 missense probably damaging 0.99
R7423:Sra1 UTSW 18 36667483 missense probably benign 0.00
R8074:Sra1 UTSW 18 36675011 missense possibly damaging 0.89
Z1176:Sra1 UTSW 18 36670009 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAGACAGCCCTAAACCTAGG -3'
(R):5'- TTCGTAGGACAGCACGTACC -3'

Sequencing Primer
(F):5'- GCCCTAAACCTAGGTATCAACTCTC -3'
(R):5'- CGTACCGAAACACGCGAGG -3'
Posted On2016-06-06