Incidental Mutation 'R5034:Scyl1'
ID389478
Institutional Source Beutler Lab
Gene Symbol Scyl1
Ensembl Gene ENSMUSG00000024941
Gene NameSCY1-like 1 (S. cerevisiae)
Synonyms2810011O19Rik, mfd, mdf, Ntkl, p105
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock #R5034 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5758427-5771401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5759994 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 601 (R601S)
Ref Sequence ENSEMBL: ENSMUSP00000025890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025890] [ENSMUST00000081496]
Predicted Effect probably benign
Transcript: ENSMUST00000025890
AA Change: R601S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941
AA Change: R601S

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 30 254 3.3e-11 PFAM
Pfam:Pkinase 31 252 2e-14 PFAM
SCOP:d1gw5a_ 350 536 1e-18 SMART
low complexity region 556 577 N/A INTRINSIC
low complexity region 608 620 N/A INTRINSIC
coiled coil region 759 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081496
SMART Domains Protein: ENSMUSP00000080214
Gene: ENSMUSG00000024940

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
EGF 109 138 6.76e-3 SMART
low complexity region 140 154 N/A INTRINSIC
low complexity region 191 199 N/A INTRINSIC
low complexity region 221 233 N/A INTRINSIC
low complexity region 254 273 N/A INTRINSIC
Pfam:TB 286 323 8e-9 PFAM
EGF_CA 352 392 2.08e-12 SMART
Pfam:TB 411 451 4.8e-18 PFAM
low complexity region 526 537 N/A INTRINSIC
EGF_CA 571 612 8.71e-6 SMART
EGF_CA 613 656 2.8e-9 SMART
EGF_CA 657 699 2.48e-10 SMART
EGF_CA 700 740 4.96e-10 SMART
EGF_CA 741 781 1.69e-12 SMART
EGF_CA 782 822 1.94e-12 SMART
EGF_CA 823 862 3.27e-10 SMART
EGF_CA 863 905 3.32e-11 SMART
Pfam:TB 925 967 5.7e-16 PFAM
EGF_CA 990 1032 4.49e-8 SMART
EGF_CA 1033 1073 3.17e-8 SMART
Pfam:TB 1097 1134 1.2e-11 PFAM
EGF 1170 1203 1.53e1 SMART
EGF_CA 1204 1248 1.53e-10 SMART
Meta Mutation Damage Score 0.1736 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator belonging to the SCY1-like family of kinase-like proteins. The protein has a divergent N-terminal kinase domain that is thought to be catalytically inactive, and can bind specific DNA sequences through its C-terminal domain. It activates transcription of the telomerase reverse transcriptase and DNA polymerase beta genes. The protein has been localized to the nucleus, and also to the cytoplasm and centrosomes during mitosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation or a knock-out allele develop a motoneuron disease characterized by gait ataxia, reduced grip strength, tremors, progressive hindlimb paralysis, muscular atrophy, and motoneuron degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Scyl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Scyl1 APN 19 5766196 missense probably damaging 1.00
IGL02488:Scyl1 APN 19 5770313 nonsense probably null
IGL02816:Scyl1 APN 19 5770382 missense probably damaging 0.99
spartacus UTSW 19 5760826 missense probably damaging 1.00
R1957:Scyl1 UTSW 19 5760104 missense probably benign 0.00
R2267:Scyl1 UTSW 19 5761721 missense possibly damaging 0.78
R4598:Scyl1 UTSW 19 5770453 missense probably damaging 1.00
R5203:Scyl1 UTSW 19 5771367 start gained probably benign
R6159:Scyl1 UTSW 19 5764757 missense probably benign 0.03
R6194:Scyl1 UTSW 19 5770306 missense possibly damaging 0.96
R6360:Scyl1 UTSW 19 5760571 missense probably damaging 1.00
R6625:Scyl1 UTSW 19 5760826 missense probably damaging 1.00
R7214:Scyl1 UTSW 19 5760029 missense probably benign
R8046:Scyl1 UTSW 19 5760592 missense possibly damaging 0.70
R8068:Scyl1 UTSW 19 5760825 missense probably damaging 1.00
Z1177:Scyl1 UTSW 19 5758851 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGGATTTCCTAGGAGACAGG -3'
(R):5'- TCTGTCATCTCAACATGAAGCC -3'

Sequencing Primer
(F):5'- CCTAGGAGACAGGGTTCTTGG -3'
(R):5'- ATGAAGCCTATACCTGCATCTC -3'
Posted On2016-06-06