Incidental Mutation 'R5035:Olfr1202'
ID389487
Institutional Source Beutler Lab
Gene Symbol Olfr1202
Ensembl Gene ENSMUSG00000064084
Gene Nameolfactory receptor 1202
SynonymsMOR232-7, GA_x6K02T2Q125-50290367-50291296
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88814496-88820711 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88818099 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 309 (K309N)
Ref Sequence ENSEMBL: ENSMUSP00000150743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072057] [ENSMUST00000214703] [ENSMUST00000217059]
Predicted Effect probably benign
Transcript: ENSMUST00000072057
AA Change: K309N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000071935
Gene: ENSMUSG00000064084
AA Change: K309N

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 6.8e-47 PFAM
Pfam:7tm_1 39 285 1.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214703
AA Change: K309N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000217059
AA Change: K309N

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Olfr1202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03221:Olfr1202 APN 2 88817437 missense possibly damaging 0.54
R0105:Olfr1202 UTSW 2 88817909 missense probably damaging 1.00
R0699:Olfr1202 UTSW 2 88817224 missense probably damaging 1.00
R0709:Olfr1202 UTSW 2 88817882 missense probably benign 0.42
R1177:Olfr1202 UTSW 2 88817360 missense probably benign 0.06
R1436:Olfr1202 UTSW 2 88817992 missense possibly damaging 0.48
R1827:Olfr1202 UTSW 2 88818058 missense probably benign 0.04
R1828:Olfr1202 UTSW 2 88818058 missense probably benign 0.04
R1872:Olfr1202 UTSW 2 88817936 missense probably benign 0.02
R1878:Olfr1202 UTSW 2 88817461 missense probably benign 0.00
R4903:Olfr1202 UTSW 2 88817998 missense probably benign 0.14
R6279:Olfr1202 UTSW 2 88817375 missense probably damaging 1.00
R7402:Olfr1202 UTSW 2 88817343 missense probably damaging 1.00
R7809:Olfr1202 UTSW 2 88817558 missense probably damaging 0.96
R8172:Olfr1202 UTSW 2 88817642 missense probably damaging 1.00
R8193:Olfr1202 UTSW 2 88817459 missense probably damaging 1.00
R8673:Olfr1202 UTSW 2 88817246 missense probably benign
R8730:Olfr1202 UTSW 2 88817699 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCATATTTGTGTACATGAGACCTG -3'
(R):5'- GAATCTTAGCTTTTCTGGAAGACG -3'

Sequencing Primer
(F):5'- GTGTACATGAGACCTGTAGCTAC -3'
(R):5'- CCTAGGTTAAACTTAAATCAGAGGC -3'
Posted On2016-06-06