Incidental Mutation 'R5035:Glmp'
ID389490
Institutional Source Beutler Lab
Gene Symbol Glmp
Ensembl Gene ENSMUSG00000001418
Gene Nameglycosylated lysosomal membrane protein
SynonymsNCU-G1, 0610031J06Rik
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88325023-88331313 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to C at 88326644 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001452] [ENSMUST00000001454] [ENSMUST00000001456] [ENSMUST00000107552] [ENSMUST00000107553] [ENSMUST00000131666] [ENSMUST00000154381] [ENSMUST00000164166] [ENSMUST00000176425] [ENSMUST00000177005] [ENSMUST00000176519]
Predicted Effect probably benign
Transcript: ENSMUST00000001452
SMART Domains Protein: ENSMUSP00000001452
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 33 527 3.2e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001454
SMART Domains Protein: ENSMUSP00000001454
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 130 2.7e-26 PFAM
Pfam:NCU-G1 124 333 4.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000001456
SMART Domains Protein: ENSMUSP00000001456
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107552
SMART Domains Protein: ENSMUSP00000103176
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107553
SMART Domains Protein: ENSMUSP00000103177
Gene: ENSMUSG00000001420

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 79 89 N/A INTRINSIC
low complexity region 177 192 N/A INTRINSIC
transmembrane domain 197 219 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 312 330 N/A INTRINSIC
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131666
SMART Domains Protein: ENSMUSP00000120235
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153716
Predicted Effect probably benign
Transcript: ENSMUST00000154381
SMART Domains Protein: ENSMUSP00000134809
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
Pfam:NCU-G1 2 72 5.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164122
Predicted Effect probably benign
Transcript: ENSMUST00000164166
SMART Domains Protein: ENSMUSP00000126109
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 15 489 1.7e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168971
SMART Domains Protein: ENSMUSP00000131250
Gene: ENSMUSG00000001416

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 38 5.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176425
SMART Domains Protein: ENSMUSP00000135575
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 37 314 3.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177005
SMART Domains Protein: ENSMUSP00000135398
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 54 397 1.1e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193646
Predicted Effect probably benign
Transcript: ENSMUST00000176519
SMART Domains Protein: ENSMUSP00000135263
Gene: ENSMUSG00000001418

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
Pfam:NCU-G1 53 125 4.7e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Homozygous mutants for this allele displayed spontaneous development of liver fibrosis at 6 months and various hepatic cell phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Glmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Glmp APN 3 88325862 splice site probably null
IGL02551:Glmp APN 3 88325082 start codon destroyed probably null 0.53
IGL03212:Glmp APN 3 88328357 missense probably benign 0.01
R0325:Glmp UTSW 3 88325084 start codon destroyed probably null 0.72
R0719:Glmp UTSW 3 88326145 nonsense probably null
R0721:Glmp UTSW 3 88326145 nonsense probably null
R1617:Glmp UTSW 3 88328119 splice site probably benign
R1970:Glmp UTSW 3 88327870 missense probably damaging 1.00
R3824:Glmp UTSW 3 88326411 missense probably damaging 1.00
R3825:Glmp UTSW 3 88326411 missense probably damaging 1.00
R4521:Glmp UTSW 3 88328039 missense possibly damaging 0.60
R4697:Glmp UTSW 3 88328274 missense probably damaging 0.99
R4806:Glmp UTSW 3 88326013 intron probably benign
R4823:Glmp UTSW 3 88325223 intron probably benign
R5043:Glmp UTSW 3 88326676 intron probably benign
R5335:Glmp UTSW 3 88326655 intron probably benign
R5592:Glmp UTSW 3 88326026 intron probably benign
R5738:Glmp UTSW 3 88326138 missense probably benign 0.06
R5921:Glmp UTSW 3 88325976 missense probably benign 0.09
R6046:Glmp UTSW 3 88325188 missense probably damaging 0.96
R6103:Glmp UTSW 3 88328031 missense probably benign 0.02
R6859:Glmp UTSW 3 88328042 missense probably benign 0.30
R6943:Glmp UTSW 3 88326610 missense probably damaging 1.00
R6945:Glmp UTSW 3 88325832 missense probably benign 0.02
R7204:Glmp UTSW 3 88326610 missense probably damaging 1.00
R7770:Glmp UTSW 3 88325770 missense probably benign 0.39
R8022:Glmp UTSW 3 88326520 missense probably damaging 1.00
R8079:Glmp UTSW 3 88325738 missense probably damaging 0.98
R8296:Glmp UTSW 3 88326273 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTTTCTAGATCTGGTCGACCTG -3'
(R):5'- ACTGACTGTAGCTCTAGTTCCGG -3'

Sequencing Primer
(F):5'- TAGATCTGGTCGACCTGCTCAG -3'
(R):5'- GGGGATTTGGCACCTTCACAG -3'
Posted On2016-06-06