Incidental Mutation 'R5035:Clcnka'
ID389493
Institutional Source Beutler Lab
Gene Symbol Clcnka
Ensembl Gene ENSMUSG00000033770
Gene Namechloride channel, voltage-sensitive Ka
SynonymsCLC-K1, Clcnk1
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5035 (G1)
Quality Score207
Status Validated
Chromosome4
Chromosomal Location141384610-141398724 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 141395158 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 179 (Y179*)
Ref Sequence ENSEMBL: ENSMUSP00000122396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042617] [ENSMUST00000105790] [ENSMUST00000133676]
Predicted Effect probably null
Transcript: ENSMUST00000042617
AA Change: Y179*
SMART Domains Protein: ENSMUSP00000048520
Gene: ENSMUSG00000033770
AA Change: Y179*

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Voltage_CLC 102 514 2.1e-69 PFAM
CBS 554 604 6.54e-6 SMART
Pfam:CBS 623 679 5.7e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105790
AA Change: Y179*
SMART Domains Protein: ENSMUSP00000101416
Gene: ENSMUSG00000033770
AA Change: Y179*

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Voltage_CLC 101 514 3.1e-75 PFAM
CBS 554 604 6.54e-6 SMART
Blast:CBS 629 678 1e-20 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000133676
AA Change: Y179*
SMART Domains Protein: ENSMUSP00000122396
Gene: ENSMUSG00000033770
AA Change: Y179*

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:Voltage_CLC 101 191 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150334
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This gene is a member of the CLC family of voltage-gated chloride channels. The gene is located adjacent to a highly similar chloride channel gene on chromosome 4. This gene is syntenic with human CLCNKB (geneID:1188). Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased urine volume and decreased urine osmolarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Clcnka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Clcnka APN 4 141391401 nonsense probably null
IGL01420:Clcnka APN 4 141389332 missense probably benign 0.00
IGL01726:Clcnka APN 4 141392740 critical splice donor site probably null
IGL02676:Clcnka APN 4 141392783 missense probably damaging 0.97
IGL02983:Clcnka APN 4 141390131 missense probably damaging 0.99
IGL03182:Clcnka APN 4 141394487 missense probably damaging 1.00
free_trade UTSW 4 141395158 nonsense probably null
R0646:Clcnka UTSW 4 141396606 missense probably benign
R1292:Clcnka UTSW 4 141395592 splice site probably benign
R1479:Clcnka UTSW 4 141389447 missense possibly damaging 0.82
R1864:Clcnka UTSW 4 141392802 missense probably damaging 0.99
R3806:Clcnka UTSW 4 141387290 missense probably null 0.05
R5617:Clcnka UTSW 4 141389317 missense probably null 0.01
R5869:Clcnka UTSW 4 141394965 missense probably benign 0.08
R6048:Clcnka UTSW 4 141394487 missense probably damaging 1.00
R7042:Clcnka UTSW 4 141391380 missense probably damaging 0.97
R7068:Clcnka UTSW 4 141387110 missense probably damaging 0.99
R8016:Clcnka UTSW 4 141390152 missense possibly damaging 0.85
R8292:Clcnka UTSW 4 141397961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGCTCTCACCACTGAAGG -3'
(R):5'- TCTTTACCCTGGGCCTTAAGG -3'

Sequencing Primer
(F):5'- GAAGACTGTGGCCACGC -3'
(R):5'- CCTTAAGGCGGAAGAGGAGG -3'
Posted On2016-06-06