Incidental Mutation 'R5035:Afp'
ID389495
Institutional Source Beutler Lab
Gene Symbol Afp
Ensembl Gene ENSMUSG00000054932
Gene Namealpha fetoprotein
Synonymsalpha-foetoprotein
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location90490737-90508907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90507905 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 583 (D583G)
Ref Sequence ENSEMBL: ENSMUSP00000041006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042755]
Predicted Effect probably benign
Transcript: ENSMUST00000042755
AA Change: D583G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000041006
Gene: ENSMUSG00000054932
AA Change: D583G

DomainStartEndE-ValueType
ALBUMIN 20 201 5.33e-70 SMART
ALBUMIN 208 393 8.52e-69 SMART
ALBUMIN 400 591 6.39e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202955
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes alpha-fetoprotein, a major plasma protein produced by the yolk sac and the liver during fetal life. Alpha-fetoprotein expression in adults is often associated with hepatoma or teratoma. However, hereditary persistance of alpha-fetoprotein may also be found in individuals with no obvious pathology. The protein is thought to be the fetal counterpart of serum albumin, and the alpha-fetoprotein and albumin genes are present in tandem in the same transcriptional orientation on chromosome 4. Alpha-fetoprotein is found in monomeric as well as dimeric and trimeric forms, and binds copper, nickel, fatty acids and bilirubin. The level of alpha-fetoprotein in amniotic fluid is used to measure renal loss of protein to screen for spina bifida and anencephaly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females homozygous for targeted null mutations are sterile due to impairment of the hypothalamic/pituitary system and failure of the estrus cycle resulting in anovulation. Homozygous males are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Afp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03261:Afp APN 5 90491751 critical splice donor site probably null
R0018:Afp UTSW 5 90506741 missense probably damaging 1.00
R0387:Afp UTSW 5 90497291 missense probably damaging 1.00
R0529:Afp UTSW 5 90504395 missense probably damaging 1.00
R1401:Afp UTSW 5 90501627 splice site probably benign
R1471:Afp UTSW 5 90503682 missense possibly damaging 0.49
R1666:Afp UTSW 5 90505068 missense probably damaging 0.99
R1800:Afp UTSW 5 90490796 missense probably benign 0.00
R2138:Afp UTSW 5 90499647 missense probably damaging 1.00
R2248:Afp UTSW 5 90501570 missense probably damaging 0.99
R4324:Afp UTSW 5 90507905 missense probably benign 0.00
R4555:Afp UTSW 5 90506687 missense possibly damaging 0.88
R5241:Afp UTSW 5 90501614 missense probably benign 0.37
R5925:Afp UTSW 5 90497288 missense probably damaging 1.00
R6220:Afp UTSW 5 90504410 missense possibly damaging 0.78
R6719:Afp UTSW 5 90503703 missense probably benign 0.01
Z1088:Afp UTSW 5 90505015 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TAAACGTTCTGGGAAGGTGCG -3'
(R):5'- GCTCTTAAGTGAGGTCAGGAG -3'

Sequencing Primer
(F):5'- GGCTTTCTTTGCATGGCAGACTC -3'
(R):5'- CTCTTAAGTGAGGTCAGGAGTATTTC -3'
Posted On2016-06-06