Incidental Mutation 'R5035:Ptprz1'
ID389496
Institutional Source Beutler Lab
Gene Symbol Ptprz1
Ensembl Gene ENSMUSG00000068748
Gene Nameprotein tyrosine phosphatase, receptor type Z, polypeptide 1
SynonymsPTPzeta, RPTPz, phosphacan, Rptpbeta, DSD-1-PG, PTPbeta, Ptprz, Ptpz
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location22875502-23052916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23016215 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 837 (I837V)
Ref Sequence ENSEMBL: ENSMUSP00000143902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090568] [ENSMUST00000202102]
Predicted Effect probably benign
Transcript: ENSMUST00000090568
AA Change: I1686V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000088056
Gene: ENSMUSG00000068748
AA Change: I1686V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
low complexity region 1417 1441 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
Blast:PTPc 1497 1573 1e-12 BLAST
low complexity region 1606 1620 N/A INTRINSIC
transmembrane domain 1637 1659 N/A INTRINSIC
low complexity region 1679 1693 N/A INTRINSIC
PTPc 1720 1991 2.8e-130 SMART
PTPc 2019 2281 1.65e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202102
AA Change: I837V

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143902
Gene: ENSMUSG00000068748
AA Change: I837V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Carb_anhydrase 38 300 5.12e-99 SMART
FN3 312 397 5.53e-4 SMART
low complexity region 588 609 N/A INTRINSIC
transmembrane domain 788 810 N/A INTRINSIC
low complexity region 830 844 N/A INTRINSIC
PTPc 871 1142 2.8e-130 SMART
PTPc 1170 1432 1.65e-77 SMART
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine phosphatase family. Expression of this gene is restricted to the central nervous system (CNS), and it may be involved in the regulation of specific developmental processes in the CNS. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for targeted null mutations demonstrate an impaired ability to recover from inflamatory lesions of the CNS or gastric mucosa. Mice homozygous for a knock-out allele exhibit increased tactile and thermal nociception thresholds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Ptprz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Ptprz1 APN 6 22973054 missense probably damaging 1.00
IGL00773:Ptprz1 APN 6 23002629 missense probably benign 0.41
IGL01458:Ptprz1 APN 6 22972844 missense probably damaging 0.99
IGL01481:Ptprz1 APN 6 22999980 missense probably benign 0.05
IGL01501:Ptprz1 APN 6 22973082 missense probably damaging 1.00
IGL01601:Ptprz1 APN 6 23000438 missense probably damaging 0.99
IGL01882:Ptprz1 APN 6 23000464 missense probably damaging 1.00
IGL02058:Ptprz1 APN 6 23002503 missense probably benign 0.00
IGL02089:Ptprz1 APN 6 23033448 missense probably damaging 1.00
IGL02136:Ptprz1 APN 6 22972822 missense probably damaging 1.00
IGL02215:Ptprz1 APN 6 22965182 missense possibly damaging 0.91
IGL02220:Ptprz1 APN 6 23042743 splice site probably benign
IGL02556:Ptprz1 APN 6 22972845 missense probably benign 0.01
IGL02601:Ptprz1 APN 6 23000687 missense probably benign 0.11
IGL02620:Ptprz1 APN 6 22959740 missense probably damaging 1.00
IGL02666:Ptprz1 APN 6 23001210 missense probably benign 0.00
IGL02718:Ptprz1 APN 6 23001349 missense possibly damaging 0.77
IGL02792:Ptprz1 APN 6 22959723 missense probably damaging 1.00
IGL02894:Ptprz1 APN 6 23035149 missense probably damaging 1.00
IGL02952:Ptprz1 APN 6 23036926 missense probably damaging 1.00
IGL03003:Ptprz1 APN 6 23002583 missense probably damaging 0.98
IGL03060:Ptprz1 APN 6 22972835 missense probably damaging 1.00
IGL03170:Ptprz1 APN 6 22959767 missense probably benign 0.00
IGL03246:Ptprz1 APN 6 22986160 missense probably damaging 0.99
IGL03349:Ptprz1 APN 6 23000332 missense probably damaging 1.00
IGL03365:Ptprz1 APN 6 23030582 splice site probably benign
R0044:Ptprz1 UTSW 6 23007403 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0054:Ptprz1 UTSW 6 22986196 missense probably damaging 1.00
R0107:Ptprz1 UTSW 6 23000570 missense probably damaging 0.98
R0278:Ptprz1 UTSW 6 23000817 missense probably benign 0.31
R0345:Ptprz1 UTSW 6 23016165 missense probably damaging 1.00
R0359:Ptprz1 UTSW 6 22973176 splice site probably benign
R0743:Ptprz1 UTSW 6 23044367 nonsense probably null
R1014:Ptprz1 UTSW 6 23000644 missense probably damaging 1.00
R1016:Ptprz1 UTSW 6 23000974 missense probably damaging 1.00
R1106:Ptprz1 UTSW 6 22965749 missense probably damaging 0.99
R1391:Ptprz1 UTSW 6 23001729 missense probably benign 0.33
R1424:Ptprz1 UTSW 6 23000383 missense probably benign 0.00
R1445:Ptprz1 UTSW 6 23050474 missense probably damaging 1.00
R1496:Ptprz1 UTSW 6 23049524 splice site probably benign
R1544:Ptprz1 UTSW 6 23000748 missense possibly damaging 0.63
R1626:Ptprz1 UTSW 6 23001574 missense probably benign
R1641:Ptprz1 UTSW 6 23049606 missense probably damaging 1.00
R1757:Ptprz1 UTSW 6 23044320 missense probably damaging 1.00
R1812:Ptprz1 UTSW 6 22959712 missense probably benign 0.07
R1917:Ptprz1 UTSW 6 23035040 splice site probably benign
R1930:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1931:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R1974:Ptprz1 UTSW 6 22986311 missense probably damaging 1.00
R1992:Ptprz1 UTSW 6 22959748 missense probably benign 0.24
R1997:Ptprz1 UTSW 6 23050497 missense probably damaging 0.99
R2002:Ptprz1 UTSW 6 23027834 nonsense probably null
R2012:Ptprz1 UTSW 6 23001027 missense probably benign 0.03
R2059:Ptprz1 UTSW 6 22986323 splice site probably benign
R2061:Ptprz1 UTSW 6 23049675 critical splice donor site probably null
R2064:Ptprz1 UTSW 6 23050389 splice site probably benign
R2067:Ptprz1 UTSW 6 23050389 splice site probably benign
R2108:Ptprz1 UTSW 6 23033477 missense probably damaging 0.99
R2152:Ptprz1 UTSW 6 23030671 missense probably damaging 0.99
R2166:Ptprz1 UTSW 6 23045633 missense possibly damaging 0.90
R2183:Ptprz1 UTSW 6 23002285 missense probably benign
R2202:Ptprz1 UTSW 6 23000650 missense possibly damaging 0.63
R2238:Ptprz1 UTSW 6 22987377 missense probably damaging 1.00
R2290:Ptprz1 UTSW 6 23000991 missense probably damaging 1.00
R3027:Ptprz1 UTSW 6 23016197 missense possibly damaging 0.89
R3861:Ptprz1 UTSW 6 23036895 missense probably damaging 0.98
R4012:Ptprz1 UTSW 6 23002585 missense probably damaging 0.99
R4020:Ptprz1 UTSW 6 22959624 splice site probably benign
R4158:Ptprz1 UTSW 6 23001684 nonsense probably null
R4158:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4159:Ptprz1 UTSW 6 23001684 nonsense probably null
R4160:Ptprz1 UTSW 6 23022205 missense possibly damaging 0.73
R4606:Ptprz1 UTSW 6 23001487 missense possibly damaging 0.80
R4621:Ptprz1 UTSW 6 23001454 missense possibly damaging 0.68
R4640:Ptprz1 UTSW 6 22972798 missense probably damaging 1.00
R4731:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4732:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4733:Ptprz1 UTSW 6 23002610 missense probably benign 0.06
R4803:Ptprz1 UTSW 6 23001546 missense probably benign 0.00
R4890:Ptprz1 UTSW 6 23024958 missense probably damaging 1.00
R5052:Ptprz1 UTSW 6 23045626 missense probably damaging 1.00
R5106:Ptprz1 UTSW 6 23000028 missense probably benign 0.04
R5248:Ptprz1 UTSW 6 23001901 missense probably benign 0.11
R5292:Ptprz1 UTSW 6 23002582 missense probably benign 0.31
R5373:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5374:Ptprz1 UTSW 6 23007355 missense probably damaging 1.00
R5378:Ptprz1 UTSW 6 23007402 missense probably damaging 1.00
R5408:Ptprz1 UTSW 6 23002600 missense probably damaging 1.00
R5479:Ptprz1 UTSW 6 23001666 missense probably benign
R5524:Ptprz1 UTSW 6 22986318 splice site probably null
R5527:Ptprz1 UTSW 6 23000053 missense possibly damaging 0.66
R5557:Ptprz1 UTSW 6 23001001 missense probably benign 0.04
R5654:Ptprz1 UTSW 6 22986134 missense probably damaging 1.00
R5655:Ptprz1 UTSW 6 22999773 missense probably benign 0.00
R5658:Ptprz1 UTSW 6 23016189 missense probably damaging 1.00
R5663:Ptprz1 UTSW 6 23035143 missense probably damaging 1.00
R5765:Ptprz1 UTSW 6 23000236 missense probably damaging 1.00
R5822:Ptprz1 UTSW 6 23001445 missense probably benign 0.01
R5837:Ptprz1 UTSW 6 23001418 missense probably benign 0.00
R6108:Ptprz1 UTSW 6 23045659 missense probably damaging 1.00
R6199:Ptprz1 UTSW 6 23002471 missense probably benign 0.01
R6245:Ptprz1 UTSW 6 23051990 missense probably damaging 1.00
R6257:Ptprz1 UTSW 6 22959640 missense probably damaging 1.00
R6488:Ptprz1 UTSW 6 23001517 nonsense probably null
R6606:Ptprz1 UTSW 6 23002501 missense probably benign 0.27
R6612:Ptprz1 UTSW 6 23052082 missense probably damaging 1.00
R6824:Ptprz1 UTSW 6 23002131 missense probably benign 0.05
R6834:Ptprz1 UTSW 6 22999633 missense probably benign 0.38
R6836:Ptprz1 UTSW 6 23030665 nonsense probably null
R6991:Ptprz1 UTSW 6 23002687 missense probably benign 0.00
R7044:Ptprz1 UTSW 6 23044346 missense probably damaging 1.00
R7048:Ptprz1 UTSW 6 22961623 missense probably benign 0.18
R7225:Ptprz1 UTSW 6 23000929 missense possibly damaging 0.61
R7284:Ptprz1 UTSW 6 23000098 missense probably damaging 1.00
R7360:Ptprz1 UTSW 6 23000907 missense probably damaging 1.00
R7501:Ptprz1 UTSW 6 23001747 nonsense probably null
R7515:Ptprz1 UTSW 6 23022267 missense probably damaging 1.00
R7538:Ptprz1 UTSW 6 22999896 missense possibly damaging 0.81
R7567:Ptprz1 UTSW 6 22959780 missense probably damaging 0.97
R7599:Ptprz1 UTSW 6 23002519 missense not run
R7611:Ptprz1 UTSW 6 23001220 missense probably benign
R7685:Ptprz1 UTSW 6 23024978 missense probably damaging 1.00
R7707:Ptprz1 UTSW 6 23002296 missense probably benign 0.00
R7733:Ptprz1 UTSW 6 23000384 missense probably benign 0.31
R7786:Ptprz1 UTSW 6 23036993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTCCTGGTCATGGATCC -3'
(R):5'- TTGCCATATCATCCCTGTGACTAAG -3'

Sequencing Primer
(F):5'- ATGGATCCATGTTTGTTGTAATCTAG -3'
(R):5'- TATAGAAGACTGGTAGCCTGACAC -3'
Posted On2016-06-06