Mutagenetix > Incidental Mutations

Incidental Mutation 'R5035:Bicra'

389497

Institutional Source

Beutler Lab

Gene Symbol

Bicra

Ensembl Gene

ENSMUSG00000070808

Gene Name

BRD4 interacting chromatin remodeling complex associated protein

Synonyms

Gltscr1

MMRRC Submission

042626-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R5035 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15970672-16047921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 15979424 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 951 (R951Q)

Ref Sequence

ENSEMBL: ENSMUSP00000148012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094821] [ENSMUST00000210781]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094821
AA Change: R951Q

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000092416
Gene: ENSMUSG00000070808
AA Change: R951Q

Domain	Start	End	E-Value	Type
low complexity region	86	96	N/A	INTRINSIC
low complexity region	140	155	N/A	INTRINSIC
internal_repeat_1	156	298	1.03e-6	PROSPERO
low complexity region	308	323	N/A	INTRINSIC
low complexity region	427	443	N/A	INTRINSIC
internal_repeat_1	479	614	1.03e-6	PROSPERO
low complexity region	619	638	N/A	INTRINSIC
low complexity region	642	676	N/A	INTRINSIC
low complexity region	719	732	N/A	INTRINSIC
low complexity region	756	782	N/A	INTRINSIC
low complexity region	790	819	N/A	INTRINSIC
low complexity region	827	843	N/A	INTRINSIC
low complexity region	852	906	N/A	INTRINSIC
low complexity region	940	950	N/A	INTRINSIC
low complexity region	987	1006	N/A	INTRINSIC
Pfam:GLTSCR1	1094	1202	4.6e-43	PFAM
low complexity region	1232	1251	N/A	INTRINSIC
low complexity region	1275	1294	N/A	INTRINSIC
low complexity region	1349	1371	N/A	INTRINSIC
low complexity region	1460	1473	N/A	INTRINSIC
low complexity region	1535	1555	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209251

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210035

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210713

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210781
AA Change: R951Q

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)

Meta Mutation Damage Score

0.0948

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.8%

Validation Efficiency

98% (46/47)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acat1	T	C	9: 53,583,510	I361V	probably benign	Het
Afp	A	G	5: 90,507,905	D583G	probably benign	Het
Bcas3	C	T	11: 85,543,945	A552V	probably damaging	Het
Bfsp2	T	G	9: 103,479,866	T121P	probably benign	Het
Cdc40	G	A	10: 40,849,813	T220I	probably benign	Het
Cdk5rap3	T	C	11: 96,916,085		probably benign	Het
Clcnka	A	T	4: 141,395,158	Y179*	probably null	Het
Creb3l1	T	A	2: 91,987,086	I361F	probably benign	Het
Csmd3	T	C	15: 47,590,779	Y3557C	probably damaging	Het
Dab2ip	A	G	2: 35,709,941	S190G	probably benign	Het
Dbx1	T	C	7: 49,632,536	H307R	unknown	Het
Dock8	C	A	19: 25,086,207	P258T	probably damaging	Het
Eml6	T	C	11: 29,854,187	I305V	probably benign	Het
Frem3	T	A	8: 80,615,914	F1612Y	probably damaging	Het
Fubp1	A	G	3: 152,214,851	T76A	probably benign	Het
Glmp	G	C	3: 88,326,644		probably benign	Het
Gm20918	A	G	Y: 5,045,992	Q183R	probably benign	Het
Krt28	T	C	11: 99,366,824	N397S	probably benign	Het
Lin9	T	A	1: 180,669,198	L351I	probably benign	Het
Map3k13	T	C	16: 21,921,671	Y583H	probably benign	Het
Mcm3	A	T	1: 20,803,418		probably benign	Het
Misp	T	C	10: 79,827,956	V588A	probably benign	Het
Olfr1202	A	T	2: 88,818,099	K309N	probably benign	Het
Olfr348	A	G	2: 36,786,891	D122G	probably damaging	Het
Olfr373	T	A	8: 72,100,078	L106H	probably damaging	Het
Olfr644	G	A	7: 104,068,407	T208I	possibly damaging	Het
Olfr970	G	A	9: 39,820,094	A152T	possibly damaging	Het
Osbpl9	A	G	4: 109,066,167	F449L	probably damaging	Het
Pkhd1l1	A	G	15: 44,568,324	D3358G	probably damaging	Het
Prodh2	A	T	7: 30,506,479	S247C	possibly damaging	Het
Prr23a3	G	A	9: 98,865,130	E46K	possibly damaging	Het
Ptprz1	A	G	6: 23,016,215	I837V	probably benign	Het
Rabgap1l	A	C	1: 160,724,036	F263V	probably damaging	Het
Rnf4	A	G	5: 34,351,339	K182E	probably damaging	Het
Slc24a2	G	T	4: 87,011,706	R469S	possibly damaging	Het
Speer2	A	G	16: 69,857,941		probably null	Het
Tcrg-C4	G	T	13: 19,352,336	R188L	unknown	Het
Tg	C	A	15: 66,681,813		probably null	Het
Tns1	G	A	1: 73,953,820		probably benign	Het
Top2b	G	T	14: 16,409,966	A878S	probably benign	Het
Ugt3a2	G	A	15: 9,361,618	R160Q	probably benign	Het
Ush2a	G	T	1: 188,910,808	L4122F	probably damaging	Het

Other mutations in Bicra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Bicra	APN	7	15996577	missense	possibly damaging	0.70
IGL01521:Bicra	APN	7	15989188	missense	probably benign	0.18
IGL01690:Bicra	APN	7	15987753	missense	probably benign	0.09
IGL01721:Bicra	APN	7	15988699	missense	probably benign
IGL01994:Bicra	APN	7	15972816	missense	possibly damaging	0.46
IGL02084:Bicra	APN	7	15987738	missense	probably benign	0.09
IGL02312:Bicra	APN	7	15993141	missense	possibly damaging	0.85
IGL02686:Bicra	APN	7	15987915	missense	probably benign	0.02
IGL02727:Bicra	APN	7	15979465	missense	possibly damaging	0.95
IGL03031:Bicra	APN	7	15975801	missense	probably benign	0.16
R0003:Bicra	UTSW	7	15971887	missense	probably benign
R0025:Bicra	UTSW	7	15987511	missense	possibly damaging	0.53
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0241:Bicra	UTSW	7	15975145	missense	probably damaging	1.00
R0417:Bicra	UTSW	7	15972322	missense	probably damaging	1.00
R0437:Bicra	UTSW	7	15988762	missense	possibly damaging	0.73
R0547:Bicra	UTSW	7	15972248	missense	probably damaging	1.00
R0688:Bicra	UTSW	7	15989322	missense	probably damaging	1.00
R0855:Bicra	UTSW	7	15972004	missense	probably damaging	1.00
R1448:Bicra	UTSW	7	15988359	missense	possibly damaging	0.86
R1637:Bicra	UTSW	7	15972689	missense	probably benign	0.19
R1899:Bicra	UTSW	7	15987751	missense	possibly damaging	0.53
R2035:Bicra	UTSW	7	15996413	missense	possibly damaging	0.53
R2247:Bicra	UTSW	7	15989234	missense	probably benign	0.33
R2471:Bicra	UTSW	7	15972332	missense	probably benign	0.04
R2484:Bicra	UTSW	7	15988680	missense	possibly damaging	0.96
R3437:Bicra	UTSW	7	15989298	missense	possibly damaging	0.85
R3551:Bicra	UTSW	7	15979733	missense	probably benign	0.33
R4816:Bicra	UTSW	7	15988906	missense	possibly damaging	0.53
R4901:Bicra	UTSW	7	15987601	missense	possibly damaging	0.53
R5078:Bicra	UTSW	7	15975457	missense	probably damaging	1.00
R5094:Bicra	UTSW	7	15975371	missense	probably damaging	1.00
R5195:Bicra	UTSW	7	15979953	missense	possibly damaging	0.93
R5496:Bicra	UTSW	7	15987841	missense	probably benign	0.33
R5780:Bicra	UTSW	7	15979754	missense	possibly damaging	0.96
R6541:Bicra	UTSW	7	15979129	missense	probably benign	0.00
R6560:Bicra	UTSW	7	15989194	missense	possibly damaging	0.53
R6575:Bicra	UTSW	7	15979131	missense	probably benign	0.25
R6854:Bicra	UTSW	7	15988762	missense	probably benign	0.18
R6967:Bicra	UTSW	7	15972205	missense	probably damaging	0.97
R7283:Bicra	UTSW	7	15972500	missense	probably damaging	1.00
R7454:Bicra	UTSW	7	15972134	missense	probably benign	0.30
R7462:Bicra	UTSW	7	15979135	missense	possibly damaging	0.84
R7488:Bicra	UTSW	7	15989442	critical splice acceptor site	probably null
R7506:Bicra	UTSW	7	15988213	missense	possibly damaging	0.96
R7534:Bicra	UTSW	7	15971935	missense	probably damaging	0.98
R7915:Bicra	UTSW	7	15988522	missense	probably benign
R8063:Bicra	UTSW	7	15979044	missense	probably benign
R8147:Bicra	UTSW	7	15988470	missense	possibly damaging	0.93
R8699:Bicra	UTSW	7	15989188	missense	probably benign	0.18
R8784:Bicra	UTSW	7	15971950	missense	probably damaging	1.00
R8859:Bicra	UTSW	7	15987812	missense	possibly damaging	0.73
X0064:Bicra	UTSW	7	15975775	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAATCCCAGATGGCACCTGAGG -3'
(R):5'- TCCAGAATCAATTGGGCGCC -3'

Sequencing Primer
(F):5'- GTGGGACATGGGATCGC -3'
(R):5'- TCCAGAGGGCCCACTGC -3'

Posted On

2016-06-06