Incidental Mutation 'R5035:Prodh2'
ID389498
Institutional Source Beutler Lab
Gene Symbol Prodh2
Ensembl Gene ENSMUSG00000036892
Gene Nameproline dehydrogenase (oxidase) 2
Synonyms2510028N04Rik, POX1, 2510038B11Rik, MmPOX1
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30493622-30513402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30506479 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 247 (S247C)
Ref Sequence ENSEMBL: ENSMUSP00000114778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058280] [ENSMUST00000130839] [ENSMUST00000131040] [ENSMUST00000133318] [ENSMUST00000142575]
Predicted Effect probably benign
Transcript: ENSMUST00000058280
AA Change: S261C

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000062214
Gene: ENSMUSG00000036892
AA Change: S261C

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
Pfam:Pro_dh 87 440 3.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122876
SMART Domains Protein: ENSMUSP00000114278
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
Pfam:Pro_dh 1 82 2.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130839
SMART Domains Protein: ENSMUSP00000117480
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
low complexity region 97 112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131040
AA Change: S200C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000116662
Gene: ENSMUSG00000036892
AA Change: S200C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 65 80 N/A INTRINSIC
Pfam:Pro_dh 91 260 5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133318
SMART Domains Protein: ENSMUSP00000122546
Gene: ENSMUSG00000036892

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142514
Predicted Effect possibly damaging
Transcript: ENSMUST00000142575
AA Change: S247C

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114778
Gene: ENSMUSG00000036892
AA Change: S247C

DomainStartEndE-ValueType
low complexity region 57 68 N/A INTRINSIC
Pfam:Pro_dh 147 284 6.5e-14 PFAM
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the first step in the catabolism of trans-4-hydroxy-L-proline, an amino acid derivative obtained through food intake and collagen turnover. One of the downstream products of this catabolism is glyoxylate, which in people with disorders of glyoxalate metabolism can lead to an increase in oxalate levels and the formation of calcium-oxalate kidney stones. Therefore, this gene may serve as a therapeutic target against primary hyperoxalurias (PH). This gene is similar to proline dehydrogenase (oxidase) 1, a mitochondrial enzyme that catalyzes the first step in proline catabolism. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Prodh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Prodh2 APN 7 30511203 missense probably damaging 1.00
IGL01949:Prodh2 APN 7 30509765 critical splice acceptor site probably null
IGL02119:Prodh2 APN 7 30506504 missense probably damaging 1.00
IGL02334:Prodh2 APN 7 30506378 missense probably damaging 0.99
IGL03061:Prodh2 APN 7 30512833 nonsense probably null
R0831:Prodh2 UTSW 7 30494224 nonsense probably null
R0964:Prodh2 UTSW 7 30506281 missense probably damaging 1.00
R1295:Prodh2 UTSW 7 30494089 missense probably damaging 1.00
R4414:Prodh2 UTSW 7 30506452 missense probably damaging 1.00
R5461:Prodh2 UTSW 7 30494523 missense possibly damaging 0.92
R5643:Prodh2 UTSW 7 30506746 missense possibly damaging 0.65
R6276:Prodh2 UTSW 7 30506651 missense probably benign 0.07
R6876:Prodh2 UTSW 7 30506500 missense probably damaging 1.00
R7860:Prodh2 UTSW 7 30512639 splice site probably null
R7972:Prodh2 UTSW 7 30511155 missense probably damaging 1.00
R8040:Prodh2 UTSW 7 30506411 missense probably damaging 1.00
X0026:Prodh2 UTSW 7 30493775 missense possibly damaging 0.83
Z1177:Prodh2 UTSW 7 30493990 missense probably damaging 1.00
Z1186:Prodh2 UTSW 7 30506644 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTAACACATGGGCATCCTGG -3'
(R):5'- CTTGTCCAGATAGGCACCTC -3'

Sequencing Primer
(F):5'- ATGGGCATCCTGGCTCCC -3'
(R):5'- AAATGCCAGGCCAGCCTTG -3'
Posted On2016-06-06