Incidental Mutation 'R5035:Dbx1'
ID389499
Institutional Source Beutler Lab
Gene Symbol Dbx1
Ensembl Gene ENSMUSG00000030507
Gene Namedeveloping brain homeobox 1
SynonymsDbx, Mmox C
MMRRC Submission 042626-MU
Accession Numbers

Genbank: NM_001005232; MGI: 94867

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location49631499-49636849 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49632536 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 307 (H307R)
Ref Sequence ENSEMBL: ENSMUSP00000032717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032717]
Predicted Effect unknown
Transcript: ENSMUST00000032717
AA Change: H307R
SMART Domains Protein: ENSMUSP00000032717
Gene: ENSMUSG00000030507
AA Change: H307R

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
HOX 181 243 1.45e-23 SMART
low complexity region 299 331 N/A INTRINSIC
Meta Mutation Damage Score 0.0589 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene die at birth. V0 interneurons develop as V1 or dl6 interneurons. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(6)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Dbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dbx1 APN 7 49636474 missense probably benign 0.22
IGL02795:Dbx1 APN 7 49636577 missense probably benign 0.03
R0630:Dbx1 UTSW 7 49632696 missense probably damaging 1.00
R3104:Dbx1 UTSW 7 49636669 missense probably damaging 1.00
R3147:Dbx1 UTSW 7 49636549 missense probably damaging 1.00
R4002:Dbx1 UTSW 7 49636517 missense probably benign 0.01
R5077:Dbx1 UTSW 7 49633494 missense probably damaging 1.00
R5689:Dbx1 UTSW 7 49632771 missense probably damaging 1.00
R8054:Dbx1 UTSW 7 49632750 missense probably damaging 1.00
X0066:Dbx1 UTSW 7 49632491 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCAGGATCCTGAACAGAGG -3'
(R):5'- ATCGACGCATGAAATGGCG -3'

Sequencing Primer
(F):5'- ATCCTGAACAGAGGTGGCCAC -3'
(R):5'- CGCATGAAATGGCGGAACTCC -3'
Posted On2016-06-06