Incidental Mutation 'R5035:Olfr373'
ID389501
Institutional Source Beutler Lab
Gene Symbol Olfr373
Ensembl Gene ENSMUSG00000061561
Gene Nameolfactory receptor 373
SynonymsMOR282-2, GA_x6K02T2NUPS-231686-232630, MOR282-1
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R5035 (G1)
Quality Score181
Status Validated
Chromosome8
Chromosomal Location72083177-72103084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72100078 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 106 (L106H)
Ref Sequence ENSEMBL: ENSMUSP00000149452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074540] [ENSMUST00000213940] [ENSMUST00000215198]
Predicted Effect probably damaging
Transcript: ENSMUST00000074540
AA Change: L106H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074128
Gene: ENSMUSG00000061561
AA Change: L106H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 253 6.5e-8 PFAM
Pfam:7tm_1 41 290 4.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213940
AA Change: L106H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215198
AA Change: L106H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Olfr373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Olfr373 APN 8 72100512 missense probably damaging 1.00
IGL02440:Olfr373 APN 8 72100530 missense probably damaging 1.00
IGL03403:Olfr373 APN 8 72100497 missense probably benign 0.00
R1099:Olfr373 UTSW 8 72100659 missense probably benign 0.00
R1418:Olfr373 UTSW 8 72100387 missense probably damaging 1.00
R1452:Olfr373 UTSW 8 72100176 nonsense probably null
R1621:Olfr373 UTSW 8 72100129 missense probably damaging 1.00
R2021:Olfr373 UTSW 8 72100086 missense possibly damaging 0.90
R4230:Olfr373 UTSW 8 72100344 missense probably damaging 1.00
R4290:Olfr373 UTSW 8 72099768 missense probably benign
R6884:Olfr373 UTSW 8 72100501 missense probably benign 0.26
R6909:Olfr373 UTSW 8 72100528 missense possibly damaging 0.95
R7233:Olfr373 UTSW 8 72100056 missense probably benign
R7304:Olfr373 UTSW 8 72100346 nonsense probably null
R7312:Olfr373 UTSW 8 72099949 missense probably damaging 1.00
R7701:Olfr373 UTSW 8 72100186 missense probably damaging 1.00
R8789:Olfr373 UTSW 8 72100291 missense probably damaging 1.00
Z1088:Olfr373 UTSW 8 72100517 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGATTGCCACAGACTCCAG -3'
(R):5'- CTCACAGAAGAAGTGGTCCAC -3'

Sequencing Primer
(F):5'- GCCACAGACTCCAGGCTCC -3'
(R):5'- AGAAGTGGTCCACGGTGTG -3'
Posted On2016-06-06