Incidental Mutation 'R5035:Acat1'
ID389505
Institutional Source Beutler Lab
Gene Symbol Acat1
Ensembl Gene ENSMUSG00000032047
Gene Nameacetyl-Coenzyme A acetyltransferase 1
Synonyms6330585C21Rik, Acat
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location53580522-53610382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53583510 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 361 (I361V)
Ref Sequence ENSEMBL: ENSMUSP00000034547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034547]
Predicted Effect probably benign
Transcript: ENSMUST00000034547
AA Change: I361V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034547
Gene: ENSMUSG00000032047
AA Change: I361V

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
Pfam:Thiolase_N 39 296 3.7e-98 PFAM
Pfam:ketoacyl-synt 104 166 1.1e-8 PFAM
Pfam:Thiolase_C 303 423 1.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169317
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrially localized enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA. Defects in this gene are associated with 3-ketothiolase deficiency, an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and butanone. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Acat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Acat1 APN 9 53582595 missense probably damaging 0.98
IGL02160:Acat1 APN 9 53591987 missense probably benign 0.00
IGL02246:Acat1 APN 9 53584866 missense probably benign 0.06
IGL02582:Acat1 APN 9 53594745 missense probably benign 0.37
IGL03028:Acat1 APN 9 53594762 missense probably benign 0.14
R0637:Acat1 UTSW 9 53587531 missense probably damaging 1.00
R1200:Acat1 UTSW 9 53583510 missense possibly damaging 0.90
R1302:Acat1 UTSW 9 53589225 missense possibly damaging 0.70
R1331:Acat1 UTSW 9 53584883 missense probably benign 0.10
R3683:Acat1 UTSW 9 53587465 missense probably damaging 1.00
R4829:Acat1 UTSW 9 53591456 missense probably damaging 1.00
R5354:Acat1 UTSW 9 53589183 missense possibly damaging 0.91
R5411:Acat1 UTSW 9 53582646 missense probably damaging 1.00
R5521:Acat1 UTSW 9 53583507 nonsense probably null
R5634:Acat1 UTSW 9 53583621 intron probably benign
R5905:Acat1 UTSW 9 53592066 missense probably damaging 1.00
R6028:Acat1 UTSW 9 53592066 missense probably damaging 1.00
R6925:Acat1 UTSW 9 53592029 missense probably benign 0.12
R8298:Acat1 UTSW 9 53594424 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTAACTGTGTTCACTACTGG -3'
(R):5'- CCTTTTCAAACATCTGTGGAGAC -3'

Sequencing Primer
(F):5'- ATGGACAGAAAGGAAAACTGCTAATC -3'
(R):5'- AAGCAAAATCTGGAAAACAAATCC -3'
Posted On2016-06-06