Incidental Mutation 'R5035:Cdc40'
ID389508
Institutional Source Beutler Lab
Gene Symbol Cdc40
Ensembl Gene ENSMUSG00000038446
Gene Namecell division cycle 40
SynonymsPRP17, 1200003H23Rik, EHB3
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location40831621-40883311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40849813 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 220 (T220I)
Ref Sequence ENSEMBL: ENSMUSP00000044305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044166]
Predicted Effect probably benign
Transcript: ENSMUST00000044166
AA Change: T220I

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044305
Gene: ENSMUSG00000038446
AA Change: T220I

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 224 238 N/A INTRINSIC
WD40 277 317 6.04e-8 SMART
WD40 321 360 8.1e-9 SMART
WD40 363 404 1.58e-2 SMART
WD40 407 446 9.52e-6 SMART
WD40 452 489 2.13e1 SMART
WD40 495 536 1.4e-3 SMART
WD40 539 579 3.37e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216025
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is found to be essential for the catalytic step II in pre-mRNA splicing process. It is found in the spliceosome, and contains seven WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp17 protein, which functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. It suggests that this protein may play a role in cell cycle progression. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Cdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Cdc40 APN 10 40843128 missense probably damaging 1.00
IGL02333:Cdc40 APN 10 40867859 missense probably benign 0.00
IGL02490:Cdc40 APN 10 40841771 missense probably benign 0.39
IGL02878:Cdc40 APN 10 40843122 missense probably damaging 0.96
IGL02976:Cdc40 APN 10 40882921 missense probably benign
IGL03058:Cdc40 APN 10 40849828 missense probably benign 0.01
IGL03178:Cdc40 APN 10 40847989 missense probably benign
R0409:Cdc40 UTSW 10 40847168 missense probably damaging 0.99
R0522:Cdc40 UTSW 10 40857612 missense probably benign 0.21
R0608:Cdc40 UTSW 10 40848052 missense probably benign 0.15
R0730:Cdc40 UTSW 10 40844956 splice site probably benign
R1712:Cdc40 UTSW 10 40841376 missense probably damaging 1.00
R1940:Cdc40 UTSW 10 40883071 unclassified probably benign
R4062:Cdc40 UTSW 10 40849852 splice site probably null
R5628:Cdc40 UTSW 10 40851053 missense probably benign 0.03
R6933:Cdc40 UTSW 10 40844996 missense probably damaging 0.96
R7082:Cdc40 UTSW 10 40867873 missense probably benign
R7419:Cdc40 UTSW 10 40841443 missense probably damaging 1.00
R7625:Cdc40 UTSW 10 40848052 missense probably benign 0.15
R7834:Cdc40 UTSW 10 40882949 missense probably benign 0.00
R7908:Cdc40 UTSW 10 40848046 missense probably damaging 1.00
R8031:Cdc40 UTSW 10 40852516 missense probably benign 0.00
R8131:Cdc40 UTSW 10 40841477 missense possibly damaging 0.45
RF041:Cdc40 UTSW 10 40843123 missense probably damaging 1.00
X0026:Cdc40 UTSW 10 40841452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGATTTCGTTAGGATGCAAATTGC -3'
(R):5'- GATCTGTGTAAGAGGTGATCCGTC -3'

Sequencing Primer
(F):5'- TGCAAATTGCTCTTAATATAATGCTG -3'
(R):5'- AAGAGGTGATCCGTCTCTGGC -3'
Posted On2016-06-06