Incidental Mutation 'R5035:Bcas3'
ID389511
Institutional Source Beutler Lab
Gene Symbol Bcas3
Ensembl Gene ENSMUSG00000059439
Gene Namebreast carcinoma amplified sequence 3
Synonyms2610028P08Rik, 1500019F07Rik, rudhira, K20D4
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.746) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location85353167-85826058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85543945 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 552 (A552V)
Ref Sequence ENSEMBL: ENSMUSP00000074416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074875] [ENSMUST00000092821] [ENSMUST00000092822] [ENSMUST00000108061] [ENSMUST00000108062]
Predicted Effect probably damaging
Transcript: ENSMUST00000074875
AA Change: A552V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074416
Gene: ENSMUSG00000059439
AA Change: A552V

DomainStartEndE-ValueType
Blast:WD40 56 104 3e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 792 2.3e-33 PFAM
low complexity region 885 901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092821
SMART Domains Protein: ENSMUSP00000090496
Gene: ENSMUSG00000059439

DomainStartEndE-ValueType
Blast:WD40 56 104 3e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 776 3.8e-35 PFAM
low complexity region 870 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092822
SMART Domains Protein: ENSMUSP00000090497
Gene: ENSMUSG00000059439

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
Pfam:BCAS3 44 298 1.2e-35 PFAM
low complexity region 415 431 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108061
AA Change: A552V

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103696
Gene: ENSMUSG00000059439
AA Change: A552V

DomainStartEndE-ValueType
Blast:WD40 56 104 2e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 789 1e-33 PFAM
low complexity region 899 913 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108062
AA Change: A552V

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103697
Gene: ENSMUSG00000059439
AA Change: A552V

DomainStartEndE-ValueType
Blast:WD40 56 104 2e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 796 1.3e-28 PFAM
low complexity region 899 913 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000142596
AA Change: A78V
SMART Domains Protein: ENSMUSP00000122571
Gene: ENSMUSG00000059439
AA Change: A78V

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
Pfam:BCAS3 48 323 3e-29 PFAM
low complexity region 434 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154396
SMART Domains Protein: ENSMUSP00000122154
Gene: ENSMUSG00000059439

DomainStartEndE-ValueType
WD40 120 160 7.7e-1 SMART
WD40 170 213 2.47e1 SMART
low complexity region 260 274 N/A INTRINSIC
low complexity region 285 294 N/A INTRINSIC
Pfam:BCAS3 301 561 1e-30 PFAM
low complexity region 650 666 N/A INTRINSIC
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Bcas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Bcas3 APN 11 85365591 missense probably damaging 0.98
IGL00754:Bcas3 APN 11 85495823 splice site probably benign
IGL01712:Bcas3 APN 11 85581048 missense probably damaging 0.99
IGL02073:Bcas3 APN 11 85557437 missense probably damaging 1.00
IGL02261:Bcas3 APN 11 85531930 missense probably damaging 1.00
IGL02323:Bcas3 APN 11 85495845 missense probably damaging 0.97
IGL02493:Bcas3 APN 11 85495882 missense probably damaging 0.99
IGL02609:Bcas3 APN 11 85457894 missense probably damaging 1.00
IGL02808:Bcas3 APN 11 85495851 missense probably benign 0.02
IGL03085:Bcas3 APN 11 85476783 missense probably damaging 1.00
IGL03263:Bcas3 APN 11 85822122 intron probably benign
FR4340:Bcas3 UTSW 11 85509497 missense probably benign 0.12
FR4342:Bcas3 UTSW 11 85509497 missense probably benign 0.12
FR4589:Bcas3 UTSW 11 85509497 missense probably benign 0.12
IGL02991:Bcas3 UTSW 11 85457887 nonsense probably null
PIT4377001:Bcas3 UTSW 11 85495842 missense probably damaging 0.98
PIT4472001:Bcas3 UTSW 11 85531900 missense probably damaging 0.99
R0145:Bcas3 UTSW 11 85359610 splice site probably benign
R0257:Bcas3 UTSW 11 85822039 missense probably benign 0.00
R0276:Bcas3 UTSW 11 85470837 critical splice donor site probably null
R0485:Bcas3 UTSW 11 85495850 missense probably damaging 0.99
R1053:Bcas3 UTSW 11 85557410 missense probably benign 0.10
R1833:Bcas3 UTSW 11 85583949 missense probably benign 0.00
R2107:Bcas3 UTSW 11 85457878 missense probably damaging 0.97
R2108:Bcas3 UTSW 11 85457878 missense probably damaging 0.97
R2215:Bcas3 UTSW 11 85801943 missense probably damaging 0.99
R2404:Bcas3 UTSW 11 85354889 splice site probably benign
R2413:Bcas3 UTSW 11 85531855 missense probably damaging 1.00
R3694:Bcas3 UTSW 11 85801802 missense probably benign 0.00
R3880:Bcas3 UTSW 11 85371122 missense probably benign 0.02
R4241:Bcas3 UTSW 11 85470826 missense probably damaging 0.99
R4794:Bcas3 UTSW 11 85509468 missense probably damaging 1.00
R5073:Bcas3 UTSW 11 85371132 missense probably damaging 1.00
R5245:Bcas3 UTSW 11 85559086 missense probably damaging 1.00
R5358:Bcas3 UTSW 11 85451755 missense probably benign 0.02
R5395:Bcas3 UTSW 11 85825249 missense probably damaging 0.99
R5615:Bcas3 UTSW 11 85470761 missense probably damaging 1.00
R5753:Bcas3 UTSW 11 85822084 intron probably benign
R6198:Bcas3 UTSW 11 85509435 missense probably damaging 0.99
R6668:Bcas3 UTSW 11 85801851 missense probably damaging 0.98
R7170:Bcas3 UTSW 11 85495918 missense probably damaging 0.96
R7171:Bcas3 UTSW 11 85583937 missense probably damaging 1.00
R7672:Bcas3 UTSW 11 85395387 nonsense probably null
R7689:Bcas3 UTSW 11 85495887 missense probably benign 0.10
R7912:Bcas3 UTSW 11 85371128 missense probably damaging 1.00
R8260:Bcas3 UTSW 11 85509546 missense possibly damaging 0.50
R8292:Bcas3 UTSW 11 85457903 missense probably damaging 0.99
R8334:Bcas3 UTSW 11 85576811 missense possibly damaging 0.60
R8716:Bcas3 UTSW 11 85581042 missense probably damaging 1.00
R8812:Bcas3 UTSW 11 85559147 missense probably benign
V3553:Bcas3 UTSW 11 85822100 intron probably benign
X0020:Bcas3 UTSW 11 85531808 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGGGCCTTGTTTCTGTACCTC -3'
(R):5'- CATGGTGAGAGAATTCTTCTGCC -3'

Sequencing Primer
(F):5'- CTATCACAGTATATGTGGCA -3'
(R):5'- TGCCTTCTTTCAAAGCAAAGC -3'
Posted On2016-06-06