Incidental Mutation 'R5035:Top2b'
ID389514
Institutional Source Beutler Lab
Gene Symbol Top2b
Ensembl Gene ENSMUSG00000017485
Gene Nametopoisomerase (DNA) II beta
SynonymsD230016L12Rik, Top-2
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.911) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location16365179-16435462 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16409966 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 878 (A878S)
Ref Sequence ENSEMBL: ENSMUSP00000017629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000161693]
Predicted Effect probably benign
Transcript: ENSMUST00000017629
AA Change: A878S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: A878S

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159302
SMART Domains Protein: ENSMUSP00000123789
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
TOP4c 1 177 4.06e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160501
AA Change: A20S
SMART Domains Protein: ENSMUSP00000124889
Gene: ENSMUSG00000017485
AA Change: A20S

DomainStartEndE-ValueType
TOP4c 2 222 3.97e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161693
SMART Domains Protein: ENSMUSP00000123992
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Pfam:DNA_topoisoIV 1 117 1.2e-12 PFAM
low complexity region 161 173 N/A INTRINSIC
low complexity region 198 210 N/A INTRINSIC
low complexity region 234 256 N/A INTRINSIC
Meta Mutation Damage Score 0.2402 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Top2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Top2b APN 14 16422692 missense probably benign 0.00
IGL00730:Top2b APN 14 16389831 missense probably damaging 1.00
IGL00917:Top2b APN 14 16407354 missense probably benign 0.05
IGL01959:Top2b APN 14 16422695 missense probably benign 0.19
IGL02019:Top2b APN 14 16409965 missense probably benign 0.44
IGL02119:Top2b APN 14 16406733 missense probably damaging 1.00
IGL02136:Top2b APN 14 16407103 unclassified probably benign
IGL02148:Top2b APN 14 16400488 missense probably damaging 1.00
IGL02496:Top2b APN 14 16387335 missense probably benign
IGL02503:Top2b APN 14 16407163 missense possibly damaging 0.92
IGL02672:Top2b APN 14 16409166 unclassified probably benign
IGL02721:Top2b APN 14 16409236 missense probably damaging 1.00
IGL02886:Top2b APN 14 16365688 missense possibly damaging 0.73
IGL03252:Top2b APN 14 16393163 missense possibly damaging 0.60
PIT4434001:Top2b UTSW 14 16423780 critical splice donor site probably null
R0092:Top2b UTSW 14 16409263 missense probably damaging 1.00
R0201:Top2b UTSW 14 16383174 missense probably damaging 1.00
R0390:Top2b UTSW 14 16418442 missense probably benign 0.00
R0394:Top2b UTSW 14 16413556 splice site probably null
R1159:Top2b UTSW 14 16430329 missense possibly damaging 0.81
R1424:Top2b UTSW 14 16383177 missense probably damaging 1.00
R1519:Top2b UTSW 14 16408953 splice site probably null
R1561:Top2b UTSW 14 16398993 missense possibly damaging 0.80
R1713:Top2b UTSW 14 16409823 missense probably benign 0.05
R1987:Top2b UTSW 14 16398916 missense probably damaging 0.99
R2219:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2287:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2422:Top2b UTSW 14 16409189 missense probably damaging 1.00
R2679:Top2b UTSW 14 16413947 missense probably damaging 1.00
R3687:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3707:Top2b UTSW 14 16388447 missense probably damaging 1.00
R3810:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3812:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3815:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3816:Top2b UTSW 14 16409189 missense probably damaging 1.00
R3818:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4023:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4025:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4026:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4133:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4157:Top2b UTSW 14 16384491 missense probably benign 0.42
R4179:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4180:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4300:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4376:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4377:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4492:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4549:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4550:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4581:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4582:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4628:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4630:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4667:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4668:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4669:Top2b UTSW 14 16409189 missense probably damaging 1.00
R4698:Top2b UTSW 14 16387331 nonsense probably null
R4769:Top2b UTSW 14 16398991 missense probably damaging 1.00
R4809:Top2b UTSW 14 16383125 missense probably benign 0.06
R4899:Top2b UTSW 14 16387313 missense probably damaging 1.00
R5621:Top2b UTSW 14 16387280 missense probably damaging 1.00
R5631:Top2b UTSW 14 16409882 missense probably damaging 1.00
R5685:Top2b UTSW 14 16413666 missense probably damaging 1.00
R5732:Top2b UTSW 14 16400106 missense possibly damaging 0.92
R5939:Top2b UTSW 14 16422786 missense probably damaging 0.96
R6007:Top2b UTSW 14 16423779 critical splice donor site probably null
R6087:Top2b UTSW 14 16409864 missense probably benign 0.14
R6144:Top2b UTSW 14 16423740 missense possibly damaging 0.48
R6196:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6218:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6229:Top2b UTSW 14 16409838 missense probably damaging 1.00
R6249:Top2b UTSW 14 16399006 missense probably damaging 1.00
R6337:Top2b UTSW 14 16399026 missense possibly damaging 0.77
R6353:Top2b UTSW 14 16416671 missense probably damaging 1.00
R6512:Top2b UTSW 14 16409854 missense possibly damaging 0.94
R6573:Top2b UTSW 14 16398991 missense probably damaging 1.00
R6614:Top2b UTSW 14 16407142 nonsense probably null
R6844:Top2b UTSW 14 16429383 missense possibly damaging 0.94
R6848:Top2b UTSW 14 16409958 missense possibly damaging 0.89
R6871:Top2b UTSW 14 16409189 missense probably damaging 1.00
R6895:Top2b UTSW 14 16413604 missense probably benign 0.06
R7162:Top2b UTSW 14 16416653 missense probably benign 0.00
R7247:Top2b UTSW 14 16416962 missense probably benign 0.08
R7250:Top2b UTSW 14 16420411 missense probably benign
R7359:Top2b UTSW 14 16407376 missense probably null 1.00
R7365:Top2b UTSW 14 16416649 missense probably benign 0.04
R7493:Top2b UTSW 14 16416605 missense probably benign 0.00
R7528:Top2b UTSW 14 16395427 nonsense probably null
R7562:Top2b UTSW 14 16412946 missense probably benign 0.04
R7594:Top2b UTSW 14 16428587 missense probably benign
R7670:Top2b UTSW 14 16416620 missense possibly damaging 0.61
R7894:Top2b UTSW 14 16413081 missense possibly damaging 0.68
R8031:Top2b UTSW 14 16412986 missense probably damaging 0.98
R8150:Top2b UTSW 14 16393291 missense probably damaging 0.99
R8214:Top2b UTSW 14 16383177 missense probably damaging 1.00
R8299:Top2b UTSW 14 16386123 missense possibly damaging 0.68
X0028:Top2b UTSW 14 16384499 nonsense probably null
Z1176:Top2b UTSW 14 16395434 missense probably damaging 1.00
Z1177:Top2b UTSW 14 16416953 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCTCTCTGGCAAGACTTC -3'
(R):5'- CGGAGATTTTAAACCCTGATAAGG -3'

Sequencing Primer
(F):5'- GCAAGACTTCTTTTTCCAGCTGTGG -3'
(R):5'- TTCACCCCATAAAACTTATCTTCAG -3'
Posted On2016-06-06