Incidental Mutation 'R5035:Map3k13'
ID389519
Institutional Source Beutler Lab
Gene Symbol Map3k13
Ensembl Gene ENSMUSG00000033618
Gene Namemitogen-activated protein kinase kinase kinase 13
Synonyms
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location21794346-21933439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21921671 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 583 (Y583H)
Ref Sequence ENSEMBL: ENSMUSP00000156202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042065] [ENSMUST00000231988] [ENSMUST00000232240]
Predicted Effect probably benign
Transcript: ENSMUST00000042065
AA Change: Y583H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000047388
Gene: ENSMUSG00000033618
AA Change: Y583H

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 119 137 N/A INTRINSIC
Pfam:Pkinase 167 406 3.1e-60 PFAM
Pfam:Pkinase_Tyr 167 406 2.4e-65 PFAM
coiled coil region 456 502 N/A INTRINSIC
low complexity region 578 599 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
low complexity region 805 821 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231988
AA Change: Y583H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000232240
AA Change: Y583H

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of serine/threonine protein kinase family. This kinase contains a dual leucine-zipper motif, and has been shown to form dimers/oligomers through its leucine-zipper motif. This kinase can phosphorylate and activate MAPK8/JNK, MAP2K7/MKK7, which suggests a role in the JNK signaling pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Map3k13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Map3k13 APN 16 21921764 missense probably benign 0.00
IGL01092:Map3k13 APN 16 21928016 missense probably damaging 0.97
IGL01958:Map3k13 APN 16 21892123 missense probably benign
IGL02444:Map3k13 APN 16 21914232 missense probably benign 0.19
IGL02503:Map3k13 APN 16 21908704 missense possibly damaging 0.50
IGL02712:Map3k13 APN 16 21905255 missense probably damaging 0.99
IGL03342:Map3k13 APN 16 21892231 missense possibly damaging 0.94
R0086:Map3k13 UTSW 16 21914225 missense probably damaging 0.98
R0124:Map3k13 UTSW 16 21903756 missense possibly damaging 0.95
R0281:Map3k13 UTSW 16 21914157 missense probably damaging 1.00
R0308:Map3k13 UTSW 16 21891988 missense probably benign
R0601:Map3k13 UTSW 16 21905249 missense possibly damaging 0.95
R0669:Map3k13 UTSW 16 21906524 missense probably benign 0.03
R0918:Map3k13 UTSW 16 21926240 missense probably damaging 1.00
R1641:Map3k13 UTSW 16 21903792 missense probably damaging 1.00
R1838:Map3k13 UTSW 16 21914189 missense possibly damaging 0.92
R1891:Map3k13 UTSW 16 21911086 missense probably damaging 1.00
R2125:Map3k13 UTSW 16 21892144 missense probably benign 0.01
R2332:Map3k13 UTSW 16 21898677 splice site probably null
R2361:Map3k13 UTSW 16 21906536 missense probably benign 0.05
R4395:Map3k13 UTSW 16 21898571 missense possibly damaging 0.49
R4505:Map3k13 UTSW 16 21922178 missense probably benign 0.00
R4506:Map3k13 UTSW 16 21922178 missense probably benign 0.00
R4521:Map3k13 UTSW 16 21905775 missense possibly damaging 0.94
R4753:Map3k13 UTSW 16 21892002 missense probably benign
R4952:Map3k13 UTSW 16 21911019 missense probably benign 0.15
R5327:Map3k13 UTSW 16 21921647 missense possibly damaging 0.89
R5784:Map3k13 UTSW 16 21898641 missense possibly damaging 0.68
R5831:Map3k13 UTSW 16 21928048 makesense probably null
R5996:Map3k13 UTSW 16 21905245 missense possibly damaging 0.95
R6007:Map3k13 UTSW 16 21905183 missense possibly damaging 0.95
R6546:Map3k13 UTSW 16 21921777 missense probably benign 0.15
R6620:Map3k13 UTSW 16 21892311 missense possibly damaging 0.62
R6683:Map3k13 UTSW 16 21892312 missense probably benign 0.32
R6692:Map3k13 UTSW 16 21905237 missense possibly damaging 0.66
R6695:Map3k13 UTSW 16 21922278 missense probably benign 0.10
R6743:Map3k13 UTSW 16 21892423 missense probably damaging 0.98
R6822:Map3k13 UTSW 16 21922263 missense probably benign 0.00
R6965:Map3k13 UTSW 16 21922150 missense probably benign
R7149:Map3k13 UTSW 16 21925437 missense probably benign 0.04
R7174:Map3k13 UTSW 16 21926256 missense probably damaging 1.00
R7256:Map3k13 UTSW 16 21892238 missense probably benign 0.03
R7400:Map3k13 UTSW 16 21922322 missense probably damaging 1.00
R7733:Map3k13 UTSW 16 21921686 missense probably damaging 1.00
R7848:Map3k13 UTSW 16 21905871 missense probably damaging 0.98
R7871:Map3k13 UTSW 16 21921596 missense probably benign 0.09
R7876:Map3k13 UTSW 16 21922319 missense probably benign 0.00
R8002:Map3k13 UTSW 16 21905128 missense probably benign 0.05
R8089:Map3k13 UTSW 16 21903817 missense possibly damaging 0.48
R8341:Map3k13 UTSW 16 21921584 nonsense probably null
R8738:Map3k13 UTSW 16 21926258 missense probably damaging 1.00
Z1176:Map3k13 UTSW 16 21905162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATATTTCACCCCAGTGTTAAAC -3'
(R):5'- TTGCAATGTCCTGCCCATGC -3'

Sequencing Primer
(F):5'- CCCCAGTGTTAAACATGTTTTGATGC -3'
(R):5'- CCCATGCGCATTGAGTCTG -3'
Posted On2016-06-06