Incidental Mutation 'R5035:Speer2'
ID 389520
Institutional Source Beutler Lab
Gene Symbol Speer2
Ensembl Gene ENSMUSG00000063163
Gene Name spermatogenesis associated glutamate (E)-rich protein 2
Synonyms SPEER-2
MMRRC Submission 042626-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R5035 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 69856874-69863744 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 69857941 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000075821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076500] [ENSMUST00000164146] [ENSMUST00000166256]
AlphaFold E9Q9U2
Predicted Effect probably null
Transcript: ENSMUST00000076500
SMART Domains Protein: ENSMUSP00000075821
Gene: ENSMUSG00000063163

DomainStartEndE-ValueType
Pfam:Takusan 51 137 6.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164146
SMART Domains Protein: ENSMUSP00000126059
Gene: ENSMUSG00000063163

DomainStartEndE-ValueType
Pfam:Takusan 33 121 1.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166256
SMART Domains Protein: ENSMUSP00000130270
Gene: ENSMUSG00000063163

DomainStartEndE-ValueType
Pfam:Takusan 1 49 2.3e-14 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Krt28 T C 11: 99,366,824 N397S probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Speer2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Speer2 APN 16 69860518 missense probably benign 0.01
IGL01115:Speer2 APN 16 69861651 nonsense probably null
IGL01694:Speer2 APN 16 69858112 missense probably damaging 0.98
IGL01694:Speer2 APN 16 69858113 missense probably damaging 1.00
IGL02738:Speer2 APN 16 69861712 missense probably benign
IGL03024:Speer2 APN 16 69858115 missense possibly damaging 0.95
IGL03062:Speer2 APN 16 69857977 missense probably damaging 0.96
R0054:Speer2 UTSW 16 69858752 missense probably damaging 0.99
R1248:Speer2 UTSW 16 69857067 splice site probably null
R1952:Speer2 UTSW 16 69857164 missense probably damaging 0.96
R1993:Speer2 UTSW 16 69858077 missense probably benign 0.01
R1995:Speer2 UTSW 16 69858077 missense probably benign 0.01
R2063:Speer2 UTSW 16 69860497 missense probably benign 0.02
R2155:Speer2 UTSW 16 69860597 missense possibly damaging 0.63
R2216:Speer2 UTSW 16 69858842 missense possibly damaging 0.94
R4547:Speer2 UTSW 16 69858849 missense probably damaging 0.98
R4548:Speer2 UTSW 16 69858849 missense probably damaging 0.98
R4625:Speer2 UTSW 16 69858754 nonsense probably null
R4692:Speer2 UTSW 16 69857972 missense possibly damaging 0.91
R4841:Speer2 UTSW 16 69858100 missense probably benign 0.26
R4842:Speer2 UTSW 16 69858100 missense probably benign 0.26
R5133:Speer2 UTSW 16 69858820 missense probably null 0.06
R5812:Speer2 UTSW 16 69858895 missense possibly damaging 0.82
R6348:Speer2 UTSW 16 69858007 missense possibly damaging 0.83
R6854:Speer2 UTSW 16 69858887 missense probably damaging 0.96
R7446:Speer2 UTSW 16 69858077 missense possibly damaging 0.82
R8068:Speer2 UTSW 16 69860524 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCTCACAAGAGGCTAACTTCCC -3'
(R):5'- GGCTGCAGGATCTTACTATGCAG -3'

Sequencing Primer
(F):5'- GAGGCTAACTTCCCAGAATATGTGTG -3'
(R):5'- CAGGATCTTACTATGCAGAGGGTG -3'
Posted On 2016-06-06