Incidental Mutation 'R5036:Tsga10'
ID389522
Institutional Source Beutler Lab
Gene Symbol Tsga10
Ensembl Gene ENSMUSG00000060771
Gene Nametestis specific 10
Synonyms4933432N21Rik, Mtsga10
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R5036 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location37754776-37866429 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37783968 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 488 (V488E)
Ref Sequence ENSEMBL: ENSMUSP00000110552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041815] [ENSMUST00000088072] [ENSMUST00000114902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041815
AA Change: V488E

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000048859
Gene: ENSMUSG00000060771
AA Change: V488E

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000088072
SMART Domains Protein: ENSMUSP00000085391
Gene: ENSMUSG00000060771

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000114902
AA Change: V488E

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110552
Gene: ENSMUSG00000060771
AA Change: V488E

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
coiled coil region 24 85 N/A INTRINSIC
coiled coil region 110 249 N/A INTRINSIC
Blast:SPEC 294 391 5e-6 BLAST
Meta Mutation Damage Score 0.0674 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Tsga10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Tsga10 APN 1 37807070 missense probably damaging 0.99
IGL00579:Tsga10 APN 1 37835453 missense probably damaging 1.00
IGL00837:Tsga10 APN 1 37801911 splice site probably benign
IGL01577:Tsga10 APN 1 37835457 missense possibly damaging 0.85
IGL01727:Tsga10 APN 1 37835274 missense probably damaging 1.00
IGL02037:Tsga10 APN 1 37807017 missense probably benign 0.05
IGL02510:Tsga10 APN 1 37760985 missense possibly damaging 0.89
R0346:Tsga10 UTSW 1 37840519 missense possibly damaging 0.65
R0789:Tsga10 UTSW 1 37801787 missense possibly damaging 0.87
R0961:Tsga10 UTSW 1 37761428 critical splice donor site probably null
R1370:Tsga10 UTSW 1 37835453 missense probably damaging 1.00
R1440:Tsga10 UTSW 1 37819599 missense probably damaging 1.00
R1827:Tsga10 UTSW 1 37835580 missense probably damaging 1.00
R2504:Tsga10 UTSW 1 37815677 missense probably damaging 1.00
R3104:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3105:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3106:Tsga10 UTSW 1 37801791 missense probably damaging 1.00
R3824:Tsga10 UTSW 1 37834197 missense possibly damaging 0.73
R3825:Tsga10 UTSW 1 37834197 missense possibly damaging 0.73
R4560:Tsga10 UTSW 1 37807082 missense probably benign 0.00
R4773:Tsga10 UTSW 1 37835525 missense probably damaging 1.00
R4927:Tsga10 UTSW 1 37801850 missense probably damaging 1.00
R5326:Tsga10 UTSW 1 37761517 missense probably damaging 1.00
R5345:Tsga10 UTSW 1 37763311 missense probably damaging 1.00
R5503:Tsga10 UTSW 1 37760947 makesense probably null
R5542:Tsga10 UTSW 1 37761517 missense probably damaging 1.00
R5793:Tsga10 UTSW 1 37835459 missense probably damaging 1.00
R6340:Tsga10 UTSW 1 37835185 intron probably benign
R7096:Tsga10 UTSW 1 37840614 missense probably damaging 0.98
R7130:Tsga10 UTSW 1 37783884 missense probably damaging 1.00
R7401:Tsga10 UTSW 1 37834187 missense probably null 1.00
R7649:Tsga10 UTSW 1 37835148 missense unknown
R7773:Tsga10 UTSW 1 37835242 missense unknown
Predicted Primers PCR Primer
(F):5'- TCACAGTTCTGTCAGTGTGG -3'
(R):5'- ATCAGCACCGGTATCACCTG -3'

Sequencing Primer
(F):5'- CTTGAATCCTTTAGAATTCAGCTGTC -3'
(R):5'- ATCACCTGAGGTCTGCTAGGAG -3'
Posted On2016-06-06