Incidental Mutation 'R5036:Sdccag8'
ID389525
Institutional Source Beutler Lab
Gene Symbol Sdccag8
Ensembl Gene ENSMUSG00000026504
Gene Nameserologically defined colon cancer antigen 8
SynonymsCCCAP, 2700048G21Rik, 5730470G24Rik
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5036 (G1)
Quality Score207
Status Validated
Chromosome1
Chromosomal Location176814660-177020437 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 177011975 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 695 (R695L)
Ref Sequence ENSEMBL: ENSMUSP00000027785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027785] [ENSMUST00000123409]
Predicted Effect probably damaging
Transcript: ENSMUST00000027785
AA Change: R695L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000027785
Gene: ENSMUSG00000026504
AA Change: R695L

DomainStartEndE-ValueType
Pfam:CCCAP 6 710 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123409
SMART Domains Protein: ENSMUSP00000137948
Gene: ENSMUSG00000026504

DomainStartEndE-ValueType
low complexity region 92 105 N/A INTRINSIC
coiled coil region 132 168 N/A INTRINSIC
coiled coil region 228 278 N/A INTRINSIC
coiled coil region 307 327 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139589
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein. This protein may be involved in organizing the centrosome during interphase and mitosis. Mutations in this gene are associated with retinal-renal ciliopathy. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygotes for a null allele show postnatal lethality, cleft palate, polydactyly, enlarged lateral ventricles and impaired neuronal migration. Homozygotes for a gene trap allele show late-onset nephronophthisis associated with renal cysts and fibrosis, and retinal degeneration leading to blindness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Sdccag8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Sdccag8 APN 1 176878002 missense possibly damaging 0.67
IGL01446:Sdccag8 APN 1 176845245 missense probably damaging 1.00
IGL01794:Sdccag8 APN 1 176845307 missense possibly damaging 0.69
IGL02179:Sdccag8 APN 1 176878056 missense probably benign 0.19
IGL02313:Sdccag8 APN 1 176824755 missense possibly damaging 0.48
IGL02962:Sdccag8 APN 1 176948362 missense probably damaging 1.00
R0433:Sdccag8 UTSW 1 176844821 splice site probably null
R0762:Sdccag8 UTSW 1 176946144 missense probably benign 0.05
R1928:Sdccag8 UTSW 1 176828970 missense probably damaging 1.00
R2132:Sdccag8 UTSW 1 176955889 missense probably damaging 1.00
R2342:Sdccag8 UTSW 1 176919641 missense probably benign 0.26
R2964:Sdccag8 UTSW 1 176948371 missense possibly damaging 0.93
R3800:Sdccag8 UTSW 1 176868338 nonsense probably null
R3853:Sdccag8 UTSW 1 176853795 missense probably damaging 1.00
R4409:Sdccag8 UTSW 1 176868366 critical splice donor site probably null
R4590:Sdccag8 UTSW 1 176948292 missense probably damaging 1.00
R5083:Sdccag8 UTSW 1 176824892 missense probably damaging 1.00
R5174:Sdccag8 UTSW 1 176845350 missense probably damaging 0.99
R5739:Sdccag8 UTSW 1 176826231 missense probably benign 0.00
R5740:Sdccag8 UTSW 1 176831150 missense probably benign 0.02
R5898:Sdccag8 UTSW 1 176824822 missense probably benign 0.09
R6435:Sdccag8 UTSW 1 176814862 unclassified probably benign
R6624:Sdccag8 UTSW 1 176874812 intron probably null
R6763:Sdccag8 UTSW 1 176854627 intron probably null
R6877:Sdccag8 UTSW 1 177011935 missense probably damaging 1.00
R7130:Sdccag8 UTSW 1 176874601 missense probably damaging 0.97
R7331:Sdccag8 UTSW 1 176868290 missense possibly damaging 0.91
R7393:Sdccag8 UTSW 1 176840306 missense probably benign 0.00
X0024:Sdccag8 UTSW 1 176919629 missense probably damaging 1.00
Z1176:Sdccag8 UTSW 1 176868231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGCTAACACCTGTCACTG -3'
(R):5'- ACACTGCAGCCTAGAAAGGG -3'

Sequencing Primer
(F):5'- GAGCTAACACCTGTCACTGTCCTC -3'
(R):5'- AGAATCTGTGTTGCCATGCAGC -3'
Posted On2016-06-06