Incidental Mutation 'R5036:Gle1'
ID389526
Institutional Source Beutler Lab
Gene Symbol Gle1
Ensembl Gene ENSMUSG00000019715
Gene NameGLE1 RNA export mediator (yeast)
Synonyms4933405K21Rik
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5036 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29935426-29960371 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29936211 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 101 (S101P)
Ref Sequence ENSEMBL: ENSMUSP00000019859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019859] [ENSMUST00000046571] [ENSMUST00000113756] [ENSMUST00000113759]
Predicted Effect probably benign
Transcript: ENSMUST00000019859
AA Change: S101P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019859
Gene: ENSMUSG00000019715
AA Change: S101P

DomainStartEndE-ValueType
low complexity region 67 88 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
coiled coil region 154 275 N/A INTRINSIC
coiled coil region 306 356 N/A INTRINSIC
Pfam:GLE1 397 650 2.4e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046571
SMART Domains Protein: ENSMUSP00000049272
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113756
SMART Domains Protein: ENSMUSP00000109385
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.77e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.77e-5 PROSPERO
internal_repeat_1 262 298 8.12e-7 PROSPERO
internal_repeat_1 461 495 8.12e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000113759
SMART Domains Protein: ENSMUSP00000109388
Gene: ENSMUSG00000026790

DomainStartEndE-ValueType
internal_repeat_2 120 138 1.82e-5 PROSPERO
coiled coil region 139 211 N/A INTRINSIC
internal_repeat_2 218 236 1.82e-5 PROSPERO
internal_repeat_1 262 299 1.55e-6 PROSPERO
internal_repeat_1 462 496 1.55e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157723
Meta Mutation Damage Score 0.0820 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted 75-kDa polypeptide with high sequence and structure homology to yeast Gle1p, which is nuclear protein with a leucine-rich nuclear export sequence essential for poly(A)+RNA export. Inhibition of human GLE1L by microinjection of antibodies against GLE1L in HeLa cells resulted in inhibition of poly(A)+RNA export. Immunoflourescence studies show that GLE1L is localized at the nuclear pore complexes. This localization suggests that GLE1L may act at a terminal step in the export of mature RNA messages to the cytoplasm. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Gle1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Gle1 APN 2 29939289 splice site probably benign
IGL01880:Gle1 APN 2 29943750 missense possibly damaging 0.53
IGL02293:Gle1 APN 2 29957760 missense probably benign 0.00
IGL02859:Gle1 APN 2 29949228 missense probably damaging 1.00
IGL03368:Gle1 APN 2 29943793 missense probably damaging 1.00
R0535:Gle1 UTSW 2 29957805 missense probably damaging 1.00
R0608:Gle1 UTSW 2 29940228 missense probably benign 0.01
R0839:Gle1 UTSW 2 29958450 missense probably benign 0.28
R0908:Gle1 UTSW 2 29936121 missense probably benign 0.06
R1102:Gle1 UTSW 2 29944054 missense possibly damaging 0.88
R1202:Gle1 UTSW 2 29949265 missense probably damaging 1.00
R1302:Gle1 UTSW 2 29952552 splice site probably null
R2184:Gle1 UTSW 2 29949018 missense probably damaging 1.00
R2213:Gle1 UTSW 2 29949301 missense probably damaging 0.97
R4151:Gle1 UTSW 2 29944044 missense probably damaging 1.00
R4172:Gle1 UTSW 2 29938526 missense probably benign
R4732:Gle1 UTSW 2 29940232 missense probably damaging 0.96
R4733:Gle1 UTSW 2 29940232 missense probably damaging 0.96
R4775:Gle1 UTSW 2 29936061 missense possibly damaging 0.86
R4817:Gle1 UTSW 2 29936211 missense probably benign 0.00
R4824:Gle1 UTSW 2 29940203 missense possibly damaging 0.82
R4869:Gle1 UTSW 2 29936020 missense possibly damaging 0.69
R4909:Gle1 UTSW 2 29936080 missense probably benign 0.01
R5298:Gle1 UTSW 2 29948943 missense probably benign 0.02
R5903:Gle1 UTSW 2 29940281 missense probably benign 0.00
R6345:Gle1 UTSW 2 29936115 missense probably benign 0.00
R6529:Gle1 UTSW 2 29935527 missense possibly damaging 0.56
R7144:Gle1 UTSW 2 29943793 missense probably damaging 1.00
R8154:Gle1 UTSW 2 29938607 critical splice donor site probably null
R8203:Gle1 UTSW 2 29935510 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCAAACTGTCTTCTTACTCTGGA -3'
(R):5'- TGCTTCTCTTTAATAAACTGGTGTT -3'

Sequencing Primer
(F):5'- ATGGGTGGTAGATCACATCCTACC -3'
(R):5'- TAATTGATGAGCTCCAGGCC -3'
Posted On2016-06-06