Incidental Mutation 'R5036:Uck1'
ID389527
Institutional Source Beutler Lab
Gene Symbol Uck1
Ensembl Gene ENSMUSG00000002550
Gene Nameuridine-cytidine kinase 1
SynonymsURK1
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5036 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32255002-32260159 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 32258466 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000002625] [ENSMUST00000036473]
Predicted Effect probably benign
Transcript: ENSMUST00000002625
SMART Domains Protein: ENSMUSP00000002625
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:CoaE 30 198 1.1e-8 PFAM
Pfam:AAA_17 31 188 3.8e-8 PFAM
Pfam:PRK 31 225 1.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036473
SMART Domains Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254

DomainStartEndE-ValueType
Pfam:PMT 42 289 2.8e-96 PFAM
MIR 318 381 7.45e-8 SMART
MIR 392 449 1.65e-9 SMART
MIR 456 513 6.2e-5 SMART
Pfam:PMT_4TMC 542 740 3.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134351
Predicted Effect probably benign
Transcript: ENSMUST00000138133
SMART Domains Protein: ENSMUSP00000125350
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
Pfam:PRK 1 151 1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142797
Predicted Effect probably benign
Transcript: ENSMUST00000192998
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a uridine-cytidine kinase that catalyzes the phosphorylation of uridine and cytidine to uridine monophosphate (UMP) and cytidine monophosphate (CMP) but not the phosphorylation of deoxyribonucleosides or purine ribonucleosides. This enzyme can also phosphorylate uridine and cytidine analogs and uses both ATP and GTP as a phosphate donor. Alternative splicing results in multiple splice variants encoding distinct isoforms. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Uck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Uck1 APN 2 32259669 missense probably damaging 1.00
IGL01765:Uck1 APN 2 32258676 unclassified probably benign
IGL02028:Uck1 APN 2 32258137 missense probably damaging 1.00
IGL02863:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03114:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03159:Uck1 APN 2 32258322 missense probably benign 0.04
IGL03325:Uck1 APN 2 32258322 missense probably benign 0.04
PIT4378001:Uck1 UTSW 2 32256034 missense probably damaging 1.00
R1019:Uck1 UTSW 2 32256193 missense possibly damaging 0.88
R1332:Uck1 UTSW 2 32259654 missense probably damaging 1.00
R1336:Uck1 UTSW 2 32259654 missense probably damaging 1.00
R1428:Uck1 UTSW 2 32258355 missense probably damaging 1.00
R2173:Uck1 UTSW 2 32256076 unclassified probably benign
R2233:Uck1 UTSW 2 32258303 missense probably damaging 1.00
R2234:Uck1 UTSW 2 32258303 missense probably damaging 1.00
R2938:Uck1 UTSW 2 32256076 unclassified probably benign
R3079:Uck1 UTSW 2 32258077 unclassified probably benign
R4667:Uck1 UTSW 2 32256034 missense probably damaging 1.00
R6463:Uck1 UTSW 2 32258655 missense probably benign 0.00
R7072:Uck1 UTSW 2 32258166 missense probably damaging 1.00
R7690:Uck1 UTSW 2 32258172 missense probably benign 0.03
R8021:Uck1 UTSW 2 32259917 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGAGTCTGTGTCCACAAAGAG -3'
(R):5'- AAATGGGCAGTTTGGGCTTC -3'

Sequencing Primer
(F):5'- TGTCCACAAAGAGGCGCAG -3'
(R):5'- TGATCTGATGCACAAGACCCTG -3'
Posted On2016-06-06