Incidental Mutation 'R5036:Car1'
ID389528
Institutional Source Beutler Lab
Gene Symbol Car1
Ensembl Gene ENSMUSG00000027556
Gene Namecarbonic anhydrase 1
SynonymsCar-1, CA I
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5036 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location14766216-14808368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14776239 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 45 (D45E)
Ref Sequence ENSEMBL: ENSMUSP00000120495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094365] [ENSMUST00000144327] [ENSMUST00000181860]
Predicted Effect probably benign
Transcript: ENSMUST00000094365
AA Change: D111E

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000091925
Gene: ENSMUSG00000027556
AA Change: D111E

DomainStartEndE-ValueType
Carb_anhydrase 6 261 2e-133 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144327
AA Change: D45E

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120495
Gene: ENSMUSG00000027556
AA Change: D45E

DomainStartEndE-ValueType
Carb_anhydrase 6 92 2.08e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181860
AA Change: D111E

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137926
Gene: ENSMUSG00000027556
AA Change: D111E

DomainStartEndE-ValueType
Carb_anhydrase 6 261 2e-133 SMART
Meta Mutation Damage Score 0.4901 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This CA1 gene is closely linked to the CA2 and CA3 genes on chromosome 8. It encodes a cytosolic protein that is found at the highest level in erythrocytes. Allelic variants of this gene have been described in some populations. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: This locus controls electrophoretic variation in red blood cells. The a allele determines a slow migrating form in C57BL/6, C3H/He and other strains; the b allele determines a fast form in IS/Cam, WB/Re, SM, M. m. castaneus and M. m. molossinus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Car1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01749:Car1 APN 3 14767459 missense probably benign 0.00
IGL02975:Car1 APN 3 14777822 missense probably benign 0.31
R0432:Car1 UTSW 3 14770176 missense probably benign 0.03
R1637:Car1 UTSW 3 14777786 missense possibly damaging 0.81
R2244:Car1 UTSW 3 14770852 missense possibly damaging 0.50
R5038:Car1 UTSW 3 14770873 missense probably damaging 1.00
R5441:Car1 UTSW 3 14776304 missense probably damaging 1.00
R7477:Car1 UTSW 3 14776283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTGCAAATTATGGTGTACTGTGTC -3'
(R):5'- AACATAACTTTGGCACCCACTG -3'

Sequencing Primer
(F):5'- CTGTGTCTGATTTAATGGATTTAGGC -3'
(R):5'- ATTTCCATCGTGCACAAGGC -3'
Posted On2016-06-06