Incidental Mutation 'R5036:Gpatch3'
ID389531
Institutional Source Beutler Lab
Gene Symbol Gpatch3
Ensembl Gene ENSMUSG00000028850
Gene NameG patch domain containing 3
SynonymsGpatc3, D930035B09Rik
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5036 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133574745-133584243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133578150 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 232 (Y232C)
Ref Sequence ENSEMBL: ENSMUSP00000030662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030662]
Predicted Effect probably damaging
Transcript: ENSMUST00000030662
AA Change: Y232C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030662
Gene: ENSMUSG00000028850
AA Change: Y232C

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
low complexity region 274 305 N/A INTRINSIC
G_patch 409 457 1.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154648
Meta Mutation Damage Score 0.7317 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Gpatch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Gpatch3 APN 4 133580717 unclassified probably benign
IGL02876:Gpatch3 APN 4 133580684 missense probably damaging 1.00
IGL03181:Gpatch3 APN 4 133578122 missense probably damaging 1.00
ANU23:Gpatch3 UTSW 4 133578302 small deletion probably benign
PIT4585001:Gpatch3 UTSW 4 133583086 missense probably damaging 0.99
R0358:Gpatch3 UTSW 4 133577904 splice site probably null
R0383:Gpatch3 UTSW 4 133578146 missense probably damaging 1.00
R1706:Gpatch3 UTSW 4 133575173 nonsense probably null
R2269:Gpatch3 UTSW 4 133583807 missense possibly damaging 0.83
R3788:Gpatch3 UTSW 4 133575168 missense possibly damaging 0.93
R4030:Gpatch3 UTSW 4 133578147 missense possibly damaging 0.94
R4334:Gpatch3 UTSW 4 133582481 missense probably damaging 1.00
R4718:Gpatch3 UTSW 4 133582544 missense probably benign 0.37
R6032:Gpatch3 UTSW 4 133578306 missense probably benign 0.06
R6032:Gpatch3 UTSW 4 133578306 missense probably benign 0.06
R6572:Gpatch3 UTSW 4 133574880 missense probably damaging 1.00
R6923:Gpatch3 UTSW 4 133582525 missense probably damaging 1.00
R7106:Gpatch3 UTSW 4 133578203 missense probably benign 0.05
R7572:Gpatch3 UTSW 4 133574806 missense probably benign 0.01
R7737:Gpatch3 UTSW 4 133575096 missense probably benign 0.01
RF025:Gpatch3 UTSW 4 133578310 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAGAATGAAGCTTTTACCCTGGC -3'
(R):5'- CTCTGCAAAGTGCTACACTACTTAC -3'

Sequencing Primer
(F):5'- TTACCCTGGCTGACCTGAAG -3'
(R):5'- ACTTACCTCTTCTGAGCCAGAC -3'
Posted On2016-06-06