Incidental Mutation 'R5036:Odc1'
ID389544
Institutional Source Beutler Lab
Gene Symbol Odc1
Ensembl Gene ENSMUSG00000011179
Gene Nameornithine decarboxylase, structural 1
SynonymsODC
MMRRC Submission 042627-MU
Accession Numbers

Genbank: NM_013614.2

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5036 (G1)
Quality Score175
Status Validated
Chromosome12
Chromosomal Location17544794-17551505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 17548019 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 116 (Q116K)
Ref Sequence ENSEMBL: ENSMUSP00000128661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171737] [ENSMUST00000222617]
PDB Structure
CRYSTAL STRUCTURE ORNITHINE DECARBOXYLASE FROM MOUSE, TRUNCATED 37 RESIDUES FROM THE C-TERMINUS, TO 1.6 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082493
Predicted Effect probably damaging
Transcript: ENSMUST00000171737
AA Change: Q116K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128661
Gene: ENSMUSG00000011179
AA Change: Q116K

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 282 2.2e-93 PFAM
Pfam:Orn_DAP_Arg_deC 286 407 1.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221354
Predicted Effect possibly damaging
Transcript: ENSMUST00000221613
AA Change: Q63K

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222250
Predicted Effect probably benign
Transcript: ENSMUST00000222617
Meta Mutation Damage Score 0.7658 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the rate-limiting enzyme of the polyamine biosynthesis pathway which catalyzes ornithine to putrescine. The activity level for the enzyme varies in response to growth-promoting stimuli and exhibits a high turnover rate in comparison to other mammalian proteins. Originally localized to both chromosomes 2 and 7, the gene encoding this enzyme has been determined to be located on 2p25, with a pseudogene located on 7q31-qter. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous null embryos die prior to gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(3) Gene trapped(6)  

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Serpina1c A G 12: 103,898,826 I187T probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Odc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Odc1 APN 12 17547673 missense probably damaging 1.00
IGL02234:Odc1 APN 12 17548620 missense possibly damaging 0.95
IGL03007:Odc1 APN 12 17548810 missense probably benign 0.01
F5426:Odc1 UTSW 12 17549423 critical splice acceptor site probably null
H8562:Odc1 UTSW 12 17548037 missense probably benign 0.11
R1648:Odc1 UTSW 12 17548537 splice site probably benign
R1898:Odc1 UTSW 12 17548841 missense probably damaging 1.00
R2224:Odc1 UTSW 12 17547335 missense probably benign 0.05
R2274:Odc1 UTSW 12 17548424 missense probably benign 0.01
R3932:Odc1 UTSW 12 17548800 missense probably benign 0.38
R4883:Odc1 UTSW 12 17547385 missense possibly damaging 0.82
R4956:Odc1 UTSW 12 17547957 missense probably damaging 1.00
R6112:Odc1 UTSW 12 17549472 missense probably benign 0.23
R6261:Odc1 UTSW 12 17550654 missense probably benign 0.00
R7092:Odc1 UTSW 12 17548313 missense possibly damaging 0.90
R7101:Odc1 UTSW 12 17547318 missense probably benign
R7243:Odc1 UTSW 12 17550057 nonsense probably null
R7638:Odc1 UTSW 12 17550002 missense probably damaging 0.99
Z1177:Odc1 UTSW 12 17550722 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGGAGGCATCAGTTGTG -3'
(R):5'- TGTCTGACACAGGGTTTAGCC -3'

Sequencing Primer
(F):5'- GGAGGCATCAGTTGTGTTAATAAG -3'
(R):5'- GACACAGGGTTTAGCCTAGTTCTAC -3'
Posted On2016-06-06