Incidental Mutation 'R5036:Serpina1c'
ID389545
Institutional Source Beutler Lab
Gene Symbol Serpina1c
Ensembl Gene ENSMUSG00000079015
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 1C
SynonymsPI3, PI6, Spi1-6, Spi1-3
MMRRC Submission 042627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5036 (G1)
Quality Score94
Status Not validated
Chromosome12
Chromosomal Location103894926-103904887 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103898826 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 187 (I187T)
Ref Sequence ENSEMBL: ENSMUSP00000073695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074051]
Predicted Effect probably damaging
Transcript: ENSMUST00000074051
AA Change: I187T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073695
Gene: ENSMUSG00000079015
AA Change: I187T

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
SERPIN 53 410 5.23e-201 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130054
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik G A 7: 41,626,154 G427D possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
C4b T A 17: 34,740,445 probably null Het
Cabyr A T 18: 12,751,246 E263D probably damaging Het
Car1 A T 3: 14,776,239 D45E possibly damaging Het
Col25a1 T C 3: 130,583,329 probably null Het
Dnah6 G T 6: 73,044,691 S3549R probably benign Het
Dync1h1 A T 12: 110,630,535 I1639F probably damaging Het
Fhad1 A T 4: 141,920,741 D271E probably benign Het
Gle1 T C 2: 29,936,211 S101P probably benign Het
Gm4781 C A 10: 100,396,989 noncoding transcript Het
Gpatch3 A G 4: 133,578,150 Y232C probably damaging Het
Gtf2ird2 A G 5: 134,217,507 N869S probably damaging Het
Ifi204 G A 1: 173,752,745 P400S possibly damaging Het
Ighv2-2 T C 12: 113,588,472 T49A possibly damaging Het
Itsn1 T A 16: 91,782,235 probably benign Het
Mib2 A T 4: 155,656,288 N626K probably damaging Het
Nf1 C A 11: 79,446,864 Q1098K probably damaging Het
Odc1 C A 12: 17,548,019 Q116K probably damaging Het
Otof C T 5: 30,384,439 E761K possibly damaging Het
Palld A T 8: 61,550,162 V301D probably damaging Het
Pask A T 1: 93,322,079 L533* probably null Het
Plekhh2 T C 17: 84,571,761 S638P probably damaging Het
Scaf8 T A 17: 3,164,262 probably benign Het
Sdccag8 G T 1: 177,011,975 R695L probably damaging Het
Slitrk5 G T 14: 111,680,884 G647W possibly damaging Het
Sycp1 T A 3: 102,820,600 K899M probably damaging Het
Taok1 G A 11: 77,549,331 R617C probably benign Het
Tbc1d32 A C 10: 56,195,404 Y341* probably null Het
Tenm4 A G 7: 96,694,790 N267D probably damaging Het
Tenm4 T C 7: 96,852,561 V1287A probably damaging Het
Tsga10 A T 1: 37,783,968 V488E possibly damaging Het
Ttc39c G T 18: 12,687,081 probably null Het
Uck1 A T 2: 32,258,466 probably benign Het
Vmn2r98 A G 17: 19,066,157 I306V probably benign Het
Other mutations in Serpina1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01905:Serpina1c APN 12 103897059 missense possibly damaging 0.84
IGL02220:Serpina1c APN 12 103896079 missense probably damaging 1.00
IGL02250:Serpina1c APN 12 103897228 missense probably benign 0.42
R0077:Serpina1c UTSW 12 103896091 missense probably benign 0.00
R0117:Serpina1c UTSW 12 103895012 makesense probably null
R1843:Serpina1c UTSW 12 103895023 missense probably benign 0.28
R2196:Serpina1c UTSW 12 103896111 missense probably damaging 0.99
R4261:Serpina1c UTSW 12 103897080 missense probably benign 0.03
R4486:Serpina1c UTSW 12 103897000 intron probably null
R4572:Serpina1c UTSW 12 103898708 intron probably benign
R4910:Serpina1c UTSW 12 103895032 missense probably benign 0.05
R6209:Serpina1c UTSW 12 103897170 missense probably damaging 1.00
R7533:Serpina1c UTSW 12 103897307 missense probably damaging 1.00
R7618:Serpina1c UTSW 12 103898770 missense probably damaging 1.00
X0027:Serpina1c UTSW 12 103897072 missense probably benign 0.00
X0064:Serpina1c UTSW 12 103896003 critical splice donor site probably null
Z1176:Serpina1c UTSW 12 103897143 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AACGTGATGGGGCAATACCAC -3'
(R):5'- GCTGACATCCACAAGTCCTTCC -3'

Sequencing Primer
(F):5'- GGGGCAATACCACAGCTTG -3'
(R):5'- CAGACCAGACAGTGAGCTGC -3'
Posted On2016-06-06